EMAIL THIS PAGE TO A FRIEND

ADAMDEC1

ADAM-like, decysin 1

65 Gene Product Result for
Synonyms: M12.219
UniProtKB ID: O15204, B7ZAK5
Gene ID:
Human(27299) Summary: This encoded protein is thought to be a secreted protein belonging to the disintegrin metalloproteinase family. Its expression is upregulated during dendritic cells maturation. This protein may play an important role in dendritic cell function and their interactions with germinal center T cells. [provided by RefSeq, Jul 2008]
Mouse(58860) ADAM-like, decysin 1
Rat(290338) ADAM-like, decysin 1
sheep(101112701) ADAM-like, decysin 1
Domestic Rabbit(100344636) ADAM-like, decysin 1
domestic guinea pig(100731627) ADAM-like, decysin 1
naked mole-rat(101702880) ADAM-like, decysin 1
dog(608742) ADAM-like, decysin 1
Horse(100058764) ADAM-like, decysin 1
cow(505890) ADAM-like, decysin 1
domestic cat(101082561) ADAM-like, decysin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014479 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014479 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014479 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021475 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021475 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021475 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU044081 MISSION® esiRNA esiRNA human ADAMDEC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014479 Rosetta Predictions human pricing
NM_001106046 Rosetta Predictions rat pricing
XM_214222 Rosetta Predictions rat pricing
NM_021475 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014479 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103377 predicted 405
2 SASI_Hs01_00103378 predicted 756
3 SASI_Hs01_00103379 predicted 629
4 SASI_Hs02_00345721 predicted 486
5 SASI_Hs01_00103380 predicted 702
6 SASI_Hs01_00103381 predicted 748
7 SASI_Hs01_00103382 predicted 792
8 SASI_Hs01_00103383 predicted 791
9 SASI_Hs01_00103384 predicted 481
10 SASI_Hs02_00345722 predicted 1274
11 SASI_Hs01_00103385 predicted 212
12 SASI_Hs01_00103386 predicted 598
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106046 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215092 predicted 686
2 SASI_Rn02_00215093 predicted 656
3 SASI_Rn02_00215094 predicted 664
4 SASI_Rn02_00215095 predicted 700
5 SASI_Rn02_00215096 predicted 1414
6 SASI_Rn02_00215097 predicted 948
7 SASI_Rn02_00215098 predicted 1060
8 SASI_Rn02_00215099 predicted 726
9 SASI_Rn02_00215100 predicted 579
10 SASI_Rn02_00215101 predicted 851
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214222 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00196102 predicted 1384
2 SASI_Rn01_00196103 predicted 1300
3 SASI_Rn01_00196104 predicted 1377
4 SASI_Rn01_00196105 predicted 1106
5 SASI_Rn01_00196106 predicted 995
6 SASI_Rn01_00196107 predicted 1302
7 SASI_Rn01_00196108 predicted 1104
8 SASI_Rn01_00196109 predicted 835
9 SASI_Rn01_00196110 predicted 1380
10 SASI_Rn01_00196111 predicted 904
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021475 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326159 predicted 761
2 SASI_Mm01_00159051 predicted 704
3 SASI_Mm01_00159052 predicted 1419
4 SASI_Mm01_00159053 predicted 624
5 SASI_Mm02_00326160 predicted 1362
6 SASI_Mm01_00159054 predicted 604
7 SASI_Mm01_00159055 predicted 1510
8 SASI_Mm01_00159056 predicted 727
9 SASI_Mm01_00159057 predicted 643
10 SASI_Mm01_00159058 predicted 382
11 SASI_Mm01_00159050 predicted 769
12 SASI_Mm01_00159059 predicted 1528
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014479
ADAMDEC1 MISSION shRNA Bacterial Glycerol Stock
ADAM-like, decysin 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014479.3-302s21c1
Sequence:CCGGACTCAAGCAATAGCCATAAAGCTCGAGCTTTATGGCTATTGCTTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417453    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014479.3-1776s21c1
Sequence:CCGGACAGGTAAACAGATGTAATTACTCGAGTAATTACATCTGTTTACCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014479.3-1559s21c1
Sequence:CCGGTGTGAAGCCCTAACGTGTAAACTCGAGTTTACACGTTAGGGCTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014479.2-1274s1c1
Sequence:CCGGGCAAGCACCTATTCCTACAAACTCGAGTTTGTAGGAATAGGTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014479.2-344s1c1
Sequence:CCGGGCCAGACTACACTGAAACATTCTCGAGAATGTTTCAGTGTAGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014479.2-156s1c1
Sequence:CCGGCCTGAATTAACGCTCCATGAACTCGAGTTCATGGAGCGTTAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014479.2-105s1c1
Sequence:CCGGCCTGTACTTTGGCTCATTGTTCTCGAGAACAATGAGCCAAAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014479.2-786s1c1
Sequence:CCGGGATGTGATGAACCTACTCAATCTCGAGATTGAGTAGGTTCATCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014479
ADAMDEC1 MISSION shRNA shRNA Plasmid DNA
ADAM-like, decysin 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014479.3-302s21c1
Sequence:CCGGACTCAAGCAATAGCCATAAAGCTCGAGCTTTATGGCTATTGCTTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417453    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014479.3-1776s21c1
Sequence:CCGGACAGGTAAACAGATGTAATTACTCGAGTAATTACATCTGTTTACCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014479.3-1559s21c1
Sequence:CCGGTGTGAAGCCCTAACGTGTAAACTCGAGTTTACACGTTAGGGCTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014479.2-1274s1c1
Sequence:CCGGGCAAGCACCTATTCCTACAAACTCGAGTTTGTAGGAATAGGTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014479.2-344s1c1
Sequence:CCGGGCCAGACTACACTGAAACATTCTCGAGAATGTTTCAGTGTAGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014479.2-156s1c1
Sequence:CCGGCCTGAATTAACGCTCCATGAACTCGAGTTCATGGAGCGTTAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014479.2-105s1c1
Sequence:CCGGCCTGTACTTTGGCTCATTGTTCTCGAGAACAATGAGCCAAAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014479.2-786s1c1
Sequence:CCGGGATGTGATGAACCTACTCAATCTCGAGATTGAGTAGGTTCATCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014479
ADAMDEC1 MISSION shRNA Lentiviral Transduction Particles
ADAM-like, decysin 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014479.3-302s21c1
Sequence:CCGGACTCAAGCAATAGCCATAAAGCTCGAGCTTTATGGCTATTGCTTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417453    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014479.3-1776s21c1
Sequence:CCGGACAGGTAAACAGATGTAATTACTCGAGTAATTACATCTGTTTACCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014479.3-1559s21c1
Sequence:CCGGTGTGAAGCCCTAACGTGTAAACTCGAGTTTACACGTTAGGGCTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014479.2-1274s1c1
Sequence:CCGGGCAAGCACCTATTCCTACAAACTCGAGTTTGTAGGAATAGGTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014479.2-344s1c1
Sequence:CCGGGCCAGACTACACTGAAACATTCTCGAGAATGTTTCAGTGTAGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014479.2-156s1c1
Sequence:CCGGCCTGAATTAACGCTCCATGAACTCGAGTTCATGGAGCGTTAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014479.2-105s1c1
Sequence:CCGGCCTGTACTTTGGCTCATTGTTCTCGAGAACAATGAGCCAAAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014479.2-786s1c1
Sequence:CCGGGATGTGATGAACCTACTCAATCTCGAGATTGAGTAGGTTCATCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021475
ADAMDEC1 MISSION shRNA Bacterial Glycerol Stock
ADAM-like, decysin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021475.1-2048s1c1
Sequence:CCGGCCACAGAATTGTTGAGTTAATCTCGAGATTAACTCAACAATTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021475.1-136s1c1
Sequence:CCGGCCGAGTTAAAGCCTCACGAAACTCGAGTTTCGTGAGGCTTTAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021475.1-1366s1c1
Sequence:CCGGCCCTGACATGTAGGCTGAAATCTCGAGATTTCAGCCTACATGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021475.1-696s1c1
Sequence:CCGGGTGCTGGATAATGCCTATTATCTCGAGATAATAGGCATTATCCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021475.1-209s1c1
Sequence:CCGGCCAGACAGAGAGATATGGCAACTCGAGTTGCCATATCTCTCTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021475
ADAMDEC1 MISSION shRNA shRNA Plasmid DNA
ADAM-like, decysin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021475.1-2048s1c1
Sequence:CCGGCCACAGAATTGTTGAGTTAATCTCGAGATTAACTCAACAATTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021475.1-136s1c1
Sequence:CCGGCCGAGTTAAAGCCTCACGAAACTCGAGTTTCGTGAGGCTTTAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021475.1-1366s1c1
Sequence:CCGGCCCTGACATGTAGGCTGAAATCTCGAGATTTCAGCCTACATGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021475.1-696s1c1
Sequence:CCGGGTGCTGGATAATGCCTATTATCTCGAGATAATAGGCATTATCCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021475.1-209s1c1
Sequence:CCGGCCAGACAGAGAGATATGGCAACTCGAGTTGCCATATCTCTCTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021475
ADAMDEC1 MISSION shRNA Lentiviral Transduction Particles
ADAM-like, decysin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021475.1-2048s1c1
Sequence:CCGGCCACAGAATTGTTGAGTTAATCTCGAGATTAACTCAACAATTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021475.1-136s1c1
Sequence:CCGGCCGAGTTAAAGCCTCACGAAACTCGAGTTTCGTGAGGCTTTAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021475.1-1366s1c1
Sequence:CCGGCCCTGACATGTAGGCTGAAATCTCGAGATTTCAGCCTACATGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021475.1-696s1c1
Sequence:CCGGGTGCTGGATAATGCCTATTATCTCGAGATAATAGGCATTATCCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021475.1-209s1c1
Sequence:CCGGCCAGACAGAGAGATATGGCAACTCGAGTTGCCATATCTCTCTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks