EMAIL THIS PAGE TO A FRIEND

ADAMTS10

ADAM metallopeptidase with thrombospondin type 1 motif, 10

63 Gene Product Result for
Synonyms: ADAM-TS10 ADAMTS-10 WMS WMS1
UniProtKB ID: Q9H324
Gene ID:
Human(81794) Summary: This gene belongs to the ADAMTS (a disintegrin and metalloproteinase domain with thrombospondin type-1 motifs) family of zinc-dependent proteases. ADAMTS proteases are complex secreted enzymes containing a prometalloprotease domain of the reprolysin type attached to an ancillary domain with a highly conserved structure that includes at least one thrombospondin type 1 repeat. They have been demonstrated to have important roles in connective tissue organization, coagulation, inflammation, arthritis, angiogenesis and cell migration. The product of this gene plays a major role in growth and in skin, lens, and heart development. It is also a candidate gene for autosomal recessive Weill-Marchesani syndrome. [provided by RefSeq, Jul 2008]
Mouse(224697) a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 10
Rat(314655) ADAM metallopeptidase with thrombospondin type 1 motif, 10
Zebrafish(564734) ADAM metallopeptidase with thrombospondin type 1 motif, 10
domestic cat(101092419) ADAM metallopeptidase with thrombospondin type 1 motif, 10
cow(513140) ADAM metallopeptidase with thrombospondin type 1 motif, 10
dog(611267) ADAM metallopeptidase with thrombospondin type 1 motif, 10
chicken(769592) ADAM metallopeptidase with thrombospondin type 1 motif, 10
domestic guinea pig(100734296) ADAM metallopeptidase with thrombospondin type 1 motif, 10
naked mole-rat(101722293) ADAM metallopeptidase with thrombospondin type 1 motif, 10
sheep(101105076) ADAM metallopeptidase with thrombospondin type 1 motif, 10
Domestic Rabbit(100354233) ADAM metallopeptidase with thrombospondin type 1 motif, 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030957 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030957 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030957 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172619 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172619 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172619 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121871 MISSION® esiRNA esiRNA human ADAMTS10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030957 Rosetta Predictions human pricing
NM_001034930 Rosetta Predictions rat pricing
NM_172619 Rosetta Predictions mouse pricing
XM_989486 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030957 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066367 predicted 2210
2 SASI_Hs01_00066368 predicted 2135
3 SASI_Hs01_00066369 predicted 1312
4 SASI_Hs01_00066370 predicted 1728
5 SASI_Hs01_00066371 predicted 2641
6 SASI_Hs01_00066372 predicted 1024
7 SASI_Hs01_00066373 predicted 1539
8 SASI_Hs01_00066374 predicted 2017
9 SASI_Hs01_00066375 predicted 2476
10 SASI_Hs01_00066376 predicted 1455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034930 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058730 predicted 986
2 SASI_Rn01_00058731 predicted 374
3 SASI_Rn01_00058732 predicted 1158
4 SASI_Rn01_00058733 predicted 1647
5 SASI_Rn02_00204099 predicted 1385
6 SASI_Rn02_00204100 predicted 879
7 SASI_Rn01_00058736 predicted 900
8 SASI_Rn01_00058737 predicted 1321
9 SASI_Rn01_00058738 predicted 1031
10 SASI_Rn01_00058739 predicted 1419
11 SASI_Rn01_00058734 predicted 927
12 SASI_Rn01_00058735 predicted 1443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172619 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344327 predicted 1122
2 SASI_Mm01_00104554 predicted 1167
3 SASI_Mm01_00104555 predicted 883
4 SASI_Mm01_00104556 predicted 916
5 SASI_Mm01_00104558 predicted 2666
6 SASI_Mm01_00104559 predicted 1546
7 SASI_Mm01_00104560 predicted 3104
8 SASI_Mm01_00104561 predicted 2504
9 SASI_Mm01_00104562 predicted 2720
10 SASI_Mm01_00104563 predicted 3370
11 SASI_Mm01_00104557 predicted 1955
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_989486 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00221710 predicted 1181
2 SASI_Mm01_00221711 predicted 899
3 SASI_Mm01_00221712 predicted 931
4 SASI_Mm01_00221713 predicted 1973
5 SASI_Mm01_00221714 predicted 2687
6 SASI_Mm01_00221715 predicted 1561
7 SASI_Mm01_00221716 predicted 3115
8 SASI_Mm01_00221717 predicted 2525
9 SASI_Mm01_00221718 predicted 2734
10 SASI_Mm01_00221719 predicted 3392
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030957
ADAMTS10 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 10
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030957.2-3694s21c1
Sequence:CCGGAGACGGAGCCGGAAGTTATTTCTCGAGAAATAACTTCCGGCTCCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030957.2-1729s21c1
Sequence:CCGGCAAATCGCGTCAGTGTAAATACTCGAGTATTTACACTGACGCGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030957.2-2284s21c1
Sequence:CCGGCATTTGCGTCAGTGGCGAATGCTCGAGCATTCGCCACTGACGCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030957.1-2099s1c1
Sequence:CCGGCATCCCTTTCCGTGGGAAATTCTCGAGAATTTCCCACGGAAAGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030957.1-699s1c1
Sequence:CCGGGACGAGGAAGAGTACCTGATTCTCGAGAATCAGGTACTCTTCCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030957.1-1090s1c1
Sequence:CCGGGCACCGTTAACATCCTCGTAACTCGAGTTACGAGGATGTTAACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030957.1-987s1c1
Sequence:CCGGGACAAGATGATGGTGGCCTATCTCGAGATAGGCCACCATCATCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030957.1-1660s1c1
Sequence:CCGGCCTACGATGCAGATGAGCAATCTCGAGATTGCTCATCTGCATCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030957
ADAMTS10 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 10
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030957.2-3694s21c1
Sequence:CCGGAGACGGAGCCGGAAGTTATTTCTCGAGAAATAACTTCCGGCTCCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030957.2-1729s21c1
Sequence:CCGGCAAATCGCGTCAGTGTAAATACTCGAGTATTTACACTGACGCGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030957.2-2284s21c1
Sequence:CCGGCATTTGCGTCAGTGGCGAATGCTCGAGCATTCGCCACTGACGCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030957.1-2099s1c1
Sequence:CCGGCATCCCTTTCCGTGGGAAATTCTCGAGAATTTCCCACGGAAAGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030957.1-699s1c1
Sequence:CCGGGACGAGGAAGAGTACCTGATTCTCGAGAATCAGGTACTCTTCCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030957.1-1090s1c1
Sequence:CCGGGCACCGTTAACATCCTCGTAACTCGAGTTACGAGGATGTTAACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030957.1-987s1c1
Sequence:CCGGGACAAGATGATGGTGGCCTATCTCGAGATAGGCCACCATCATCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030957.1-1660s1c1
Sequence:CCGGCCTACGATGCAGATGAGCAATCTCGAGATTGCTCATCTGCATCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030957
ADAMTS10 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 10
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030957.2-3694s21c1
Sequence:CCGGAGACGGAGCCGGAAGTTATTTCTCGAGAAATAACTTCCGGCTCCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030957.2-1729s21c1
Sequence:CCGGCAAATCGCGTCAGTGTAAATACTCGAGTATTTACACTGACGCGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030957.2-2284s21c1
Sequence:CCGGCATTTGCGTCAGTGGCGAATGCTCGAGCATTCGCCACTGACGCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030957.1-2099s1c1
Sequence:CCGGCATCCCTTTCCGTGGGAAATTCTCGAGAATTTCCCACGGAAAGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030957.1-699s1c1
Sequence:CCGGGACGAGGAAGAGTACCTGATTCTCGAGAATCAGGTACTCTTCCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030957.1-1090s1c1
Sequence:CCGGGCACCGTTAACATCCTCGTAACTCGAGTTACGAGGATGTTAACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030957.1-987s1c1
Sequence:CCGGGACAAGATGATGGTGGCCTATCTCGAGATAGGCCACCATCATCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030957.1-1660s1c1
Sequence:CCGGCCTACGATGCAGATGAGCAATCTCGAGATTGCTCATCTGCATCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172619
VALIDATED
ADAMTS10 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 10
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172619.2-1589s21c1
Sequence:CCGGCAAATCGCGTCAGTGTAAATACTCGAGTATTTACACTGACGCGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172619.2-917s21c1
Sequence:CCGGGCAGTATGTGTTGGCCATCATCTCGAGATGATGGCCAACACATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172619.2-3541s21c1
Sequence:CCGGAGATGCAGTTGAAAGTTATTTCTCGAGAAATAACTTTCAACTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172619.2-3108s21c1
Sequence:CCGGCCATCTACTATGCGATGTAACCTCGAGGTTACATCGCATAGTAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172619.1-1213s1c1
Sequence:CCGGGCCCTAATACTGTGATCCTTTCTCGAGAAAGGATCACAGTATTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172619.1-664s1c1
Sequence:CCGGCCCATGTAGTATACAAGCGTTCTCGAGAACGCTTGTATACTACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172619.1-250s1c1
Sequence:CCGGGCTATGAGATTGCCTTCCCAACTCGAGTTGGGAAGGCAATCTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172619.1-920s1c1
Sequence:CCGGGCAGTATGTGTTGGCCATCATCTCGAGATGATGGCCAACACATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172619.1-189s1c1
Sequence:CCGGCTCACATTCAAGGTCACGCATCTCGAGATGCGTGACCTTGAATGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172619
VALIDATED
ADAMTS10 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 10
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172619.2-1589s21c1
Sequence:CCGGCAAATCGCGTCAGTGTAAATACTCGAGTATTTACACTGACGCGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172619.2-917s21c1
Sequence:CCGGGCAGTATGTGTTGGCCATCATCTCGAGATGATGGCCAACACATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172619.2-3541s21c1
Sequence:CCGGAGATGCAGTTGAAAGTTATTTCTCGAGAAATAACTTTCAACTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172619.2-3108s21c1
Sequence:CCGGCCATCTACTATGCGATGTAACCTCGAGGTTACATCGCATAGTAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172619.1-1213s1c1
Sequence:CCGGGCCCTAATACTGTGATCCTTTCTCGAGAAAGGATCACAGTATTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172619.1-664s1c1
Sequence:CCGGCCCATGTAGTATACAAGCGTTCTCGAGAACGCTTGTATACTACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172619.1-250s1c1
Sequence:CCGGGCTATGAGATTGCCTTCCCAACTCGAGTTGGGAAGGCAATCTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172619.1-920s1c1
Sequence:CCGGGCAGTATGTGTTGGCCATCATCTCGAGATGATGGCCAACACATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172619.1-189s1c1
Sequence:CCGGCTCACATTCAAGGTCACGCATCTCGAGATGCGTGACCTTGAATGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172619
VALIDATED
ADAMTS10 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 10
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172619.2-1589s21c1
Sequence:CCGGCAAATCGCGTCAGTGTAAATACTCGAGTATTTACACTGACGCGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172619.2-917s21c1
Sequence:CCGGGCAGTATGTGTTGGCCATCATCTCGAGATGATGGCCAACACATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172619.2-3541s21c1
Sequence:CCGGAGATGCAGTTGAAAGTTATTTCTCGAGAAATAACTTTCAACTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172619.2-3108s21c1
Sequence:CCGGCCATCTACTATGCGATGTAACCTCGAGGTTACATCGCATAGTAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172619.1-1213s1c1
Sequence:CCGGGCCCTAATACTGTGATCCTTTCTCGAGAAAGGATCACAGTATTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172619.1-664s1c1
Sequence:CCGGCCCATGTAGTATACAAGCGTTCTCGAGAACGCTTGTATACTACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172619.1-250s1c1
Sequence:CCGGGCTATGAGATTGCCTTCCCAACTCGAGTTGGGAAGGCAATCTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172619.1-920s1c1
Sequence:CCGGGCAGTATGTGTTGGCCATCATCTCGAGATGATGGCCAACACATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172619.1-189s1c1
Sequence:CCGGCTCACATTCAAGGTCACGCATCTCGAGATGCGTGACCTTGAATGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks