EMAIL THIS PAGE TO A FRIEND

ADAMTS12

ADAM metallopeptidase with thrombospondin type 1 motif, 12

51 Gene Product Result for
Synonyms: PRO4389
UniProtKB ID: P58397, A2RRN9, A5D6V6, Q6UWL3
Gene ID:
Human(81792) Summary: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS-1) motif. Individual members of this family differ in the number of C-terminal TS-1 motifs, and some have unique C-terminal domains. The enzyme encoded by this gene contains eight TS-1 motifs. It may play roles in pulmonary cells during fetal development or in tumor processes through its proteolytic activity or as a molecule potentially involved in regulation of cell adhesion. [provided by RefSeq, Jul 2008]
Mouse(239337) a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 12
Rat(294809) ADAM metallopeptidase with thrombospondin type 1 motif, 12
sheep(101118642) ADAM metallopeptidase with thrombospondin type 1 motif, 12
Domestic Rabbit(100351077) ADAM metallopeptidase with thrombospondin type 1 motif, 12
naked mole-rat(101721116) ADAM metallopeptidase with thrombospondin type 1 motif, 12
domestic guinea pig(100723731) ADAM metallopeptidase with thrombospondin type 1 motif, 12
chicken(427428) ADAM metallopeptidase with thrombospondin type 1 motif, 12
cow(525276) ADAM metallopeptidase with thrombospondin type 1 motif, 12
domestic cat(101098689) ADAM metallopeptidase with thrombospondin type 1 motif, 12
Horse(100068281) ADAM metallopeptidase with thrombospondin type 1 motif, 12
dog(479369) ADAM metallopeptidase with thrombospondin type 1 motif, 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175501 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175501 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175501 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030955 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030955 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030955 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU001931 MISSION® esiRNA esiRNA targeting human ADAMTS12 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030955 Rosetta Predictions human pricing
NM_001106420 Rosetta Predictions rat pricing
NM_175501 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030955 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067584 predicted 1136
2 SASI_Hs01_00067585 predicted 3082
3 SASI_Hs01_00067586 predicted 4032
4 SASI_Hs01_00067587 predicted 3150
5 SASI_Hs01_00067588 predicted 1010
6 SASI_Hs02_00358535 predicted 930
7 SASI_Hs01_00067591 predicted 4021
8 SASI_Hs01_00067592 predicted 2696
9 SASI_Hs02_00358536 predicted 4398
10 SASI_Hs01_00067593 predicted 2299
11 SASI_Hs01_00067589 predicted 2189
12 SASI_Hs01_00067590 predicted 2318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106420 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218788 predicted 1893
2 SASI_Rn02_00218789 predicted 1786
3 SASI_Rn02_00218790 predicted 2181
4 SASI_Rn02_00218791 predicted 1756
5 SASI_Rn02_00218792 predicted 3127
6 SASI_Rn02_00218793 predicted 2956
7 SASI_Rn02_00218794 predicted 3608
8 SASI_Rn02_00218795 predicted 2012
9 SASI_Rn02_00218796 predicted 3656
10 SASI_Rn02_00218797 predicted 3155
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175501 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144560 predicted 4161
2 SASI_Mm01_00144561 predicted 2286
3 SASI_Mm01_00144562 predicted 3393
4 SASI_Mm01_00144563 predicted 4112
5 SASI_Mm02_00346413 predicted 5115
6 SASI_Mm02_00346414 predicted 3239
7 SASI_Mm01_00144564 predicted 1978
8 SASI_Mm01_00144565 predicted 563
9 SASI_Mm01_00144567 predicted 3778
10 SASI_Mm01_00144568 predicted 3445
11 SASI_Mm01_00144559 predicted 2342
12 SASI_Mm01_00144566 predicted 3029
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175501
ADAMTS12 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 12
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175501.1-901s1c1
Sequence:CCGGCGGCTCATTCTACTTGAAGAACTCGAGTTCTTCAAGTAGAATGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175501.1-1572s1c1
Sequence:CCGGCGGTGAGAAGAAGTGGTGTATCTCGAGATACACCACTTCTTCTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175501.1-2421s1c1
Sequence:CCGGCCCTGGTATCAAGTATGAGTACTCGAGTACTCATACTTGATACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175501.1-1885s1c1
Sequence:CCGGCCAGTGTTTAATGCAGCACATCTCGAGATGTGCTGCATTAAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175501.1-4610s1c1
Sequence:CCGGGCAGGAAGAGTGCTGATTTAACTCGAGTTAAATCAGCACTCTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175501
ADAMTS12 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 12
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175501.1-901s1c1
Sequence:CCGGCGGCTCATTCTACTTGAAGAACTCGAGTTCTTCAAGTAGAATGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175501.1-1572s1c1
Sequence:CCGGCGGTGAGAAGAAGTGGTGTATCTCGAGATACACCACTTCTTCTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175501.1-2421s1c1
Sequence:CCGGCCCTGGTATCAAGTATGAGTACTCGAGTACTCATACTTGATACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175501.1-1885s1c1
Sequence:CCGGCCAGTGTTTAATGCAGCACATCTCGAGATGTGCTGCATTAAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175501.1-4610s1c1
Sequence:CCGGGCAGGAAGAGTGCTGATTTAACTCGAGTTAAATCAGCACTCTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175501
ADAMTS12 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 12
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175501.1-901s1c1
Sequence:CCGGCGGCTCATTCTACTTGAAGAACTCGAGTTCTTCAAGTAGAATGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175501.1-1572s1c1
Sequence:CCGGCGGTGAGAAGAAGTGGTGTATCTCGAGATACACCACTTCTTCTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175501.1-2421s1c1
Sequence:CCGGCCCTGGTATCAAGTATGAGTACTCGAGTACTCATACTTGATACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175501.1-1885s1c1
Sequence:CCGGCCAGTGTTTAATGCAGCACATCTCGAGATGTGCTGCATTAAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175501.1-4610s1c1
Sequence:CCGGGCAGGAAGAGTGCTGATTTAACTCGAGTTAAATCAGCACTCTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030955
VALIDATED
ADAMTS12 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 12
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030955.1-1215s1c1
Sequence:CCGGCGGCTCATTCTACTCGAAGAACTCGAGTTCTTCGAGTAGAATGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030955.1-1728s1c1
Sequence:CCGGCCCGGAGTGATCTATGATGTTCTCGAGAACATCATAGATCACTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030955.1-3760s1c1
Sequence:CCGGCCTTGACCAAAGGTCCAGAAACTCGAGTTTCTGGACCTTTGGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030955.1-1446s1c1
Sequence:CCGGCGCAGTTGTAACATCAATGAACTCGAGTTCATTGATGTTACAACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030955.1-2735s1c1
Sequence:CCGGCCCTGGCATCAAGTATGAGTACTCGAGTACTCATACTTGATGCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030955.2-3390s21c1
Sequence:CCGGTGAGCTCTCGCTATCTCATTTCTCGAGAAATGAGATAGCGAGAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030955.2-2441s21c1
Sequence:CCGGCAGTGGAACGGGAACTATAAGCTCGAGCTTATAGTTCCCGTTCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030955.2-727s21c1
Sequence:CCGGGTACCACCCGCACATCGTTTACTCGAGTAAACGATGTGCGGGTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030955
VALIDATED
ADAMTS12 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 12
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030955.1-1215s1c1
Sequence:CCGGCGGCTCATTCTACTCGAAGAACTCGAGTTCTTCGAGTAGAATGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030955.1-1728s1c1
Sequence:CCGGCCCGGAGTGATCTATGATGTTCTCGAGAACATCATAGATCACTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030955.1-3760s1c1
Sequence:CCGGCCTTGACCAAAGGTCCAGAAACTCGAGTTTCTGGACCTTTGGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030955.1-1446s1c1
Sequence:CCGGCGCAGTTGTAACATCAATGAACTCGAGTTCATTGATGTTACAACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030955.1-2735s1c1
Sequence:CCGGCCCTGGCATCAAGTATGAGTACTCGAGTACTCATACTTGATGCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030955.2-3390s21c1
Sequence:CCGGTGAGCTCTCGCTATCTCATTTCTCGAGAAATGAGATAGCGAGAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030955.2-2441s21c1
Sequence:CCGGCAGTGGAACGGGAACTATAAGCTCGAGCTTATAGTTCCCGTTCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030955.2-727s21c1
Sequence:CCGGGTACCACCCGCACATCGTTTACTCGAGTAAACGATGTGCGGGTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030955
VALIDATED
ADAMTS12 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 12
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030955.1-1215s1c1
Sequence:CCGGCGGCTCATTCTACTCGAAGAACTCGAGTTCTTCGAGTAGAATGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030955.1-1728s1c1
Sequence:CCGGCCCGGAGTGATCTATGATGTTCTCGAGAACATCATAGATCACTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030955.1-3760s1c1
Sequence:CCGGCCTTGACCAAAGGTCCAGAAACTCGAGTTTCTGGACCTTTGGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030955.1-1446s1c1
Sequence:CCGGCGCAGTTGTAACATCAATGAACTCGAGTTCATTGATGTTACAACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030955.1-2735s1c1
Sequence:CCGGCCCTGGCATCAAGTATGAGTACTCGAGTACTCATACTTGATGCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030955.2-3390s21c1
Sequence:CCGGTGAGCTCTCGCTATCTCATTTCTCGAGAAATGAGATAGCGAGAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030955.2-2441s21c1
Sequence:CCGGCAGTGGAACGGGAACTATAAGCTCGAGCTTATAGTTCCCGTTCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030955.2-727s21c1
Sequence:CCGGGTACCACCCGCACATCGTTTACTCGAGTAAACGATGTGCGGGTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks