EMAIL THIS PAGE TO A FRIEND

ADAMTS13

ADAM metallopeptidase with thrombospondin type 1 motif, 13

Synonyms: ADAM-TS13 ADAMTS-13 C9orf8 VWFCP vWF-CP
UniProtKB ID: Q76LX8, Q6UY16, Q710F6, Q711T8, Q96L37, Q9H0G3
Gene ID:
Human(11093) Summary: This gene encodes a member of a family of proteins containing several distinct regions, including a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. The enzyme encoded by this gene specifically cleaves von Willebrand Factor (vWF). Defects in this gene are associated with thrombotic thrombocytopenic purpura. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Mouse(279028) a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 13
Rat(362091) ADAM metallopeptidase with thrombospondin type 1 motif, 13
Zebrafish(100320289) ADAM metallopeptidase with thrombospondin type 1 motif, 13
cow(532272) ADAM metallopeptidase with thrombospondin type 1 motif, 13
Horse(100069281) ADAM metallopeptidase with thrombospondin type 1 motif, 13
domestic cat(101086761) ADAM metallopeptidase with thrombospondin type 1 motif, 13
dog(100630922) ADAM metallopeptidase with thrombospondin type 1 motif, 13
chicken(417152) ADAM metallopeptidase with thrombospondin type 1 motif, 13
domestic guinea pig(100727045) ADAM metallopeptidase with thrombospondin type 1 motif, 13
naked mole-rat(101713585) ADAM metallopeptidase with thrombospondin type 1 motif, 13
sheep(101112214) ADAM metallopeptidase with thrombospondin type 1 motif, 13
Domestic Rabbit(100343027) ADAM metallopeptidase with thrombospondin type 1 motif, 13
167 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139025 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139025 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139025 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_205053 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_205053 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_205053 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139025 Rosetta Predictions human pricing
NM_139026 Rosetta Predictions human pricing
NM_139027 Rosetta Predictions human pricing
NM_139028 Rosetta Predictions human pricing
XM_001078796 Rosetta Predictions rat pricing
XM_342395 Rosetta Predictions rat pricing
NM_001001322 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139025 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364071 predicted 4506
2 SASI_Hs01_00083830 predicted 744
3 SASI_Hs02_00364072 predicted 2136
4 SASI_Hs01_00083833 predicted 964
5 SASI_Hs01_00083834 predicted 2151
6 SASI_Hs02_00364073 predicted 4209
7 SASI_Hs01_00083836 predicted 917
8 SASI_Hs01_00083837 predicted 1771
9 SASI_Hs01_00083839 predicted 3166
10 SASI_Hs02_00364074 predicted 4331
11 SASI_Hs01_00083831 predicted 2050
12 SASI_Hs01_00083832 predicted 961
13 SASI_Hs01_00083835 predicted 1912
14 SASI_Hs01_00083838 predicted 1909
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139026 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364075 predicted 4241
2 SASI_Hs01_00222062 predicted 744
3 SASI_Hs02_00364076 predicted 2046
4 SASI_Hs01_00222065 predicted 962
5 SASI_Hs01_00222066 predicted 2052
6 SASI_Hs02_00364077 predicted 3953
7 SASI_Hs01_00222068 predicted 918
8 SASI_Hs01_00222069 predicted 1674
9 SASI_Hs01_00222071 predicted 3077
10 SASI_Hs02_00364078 predicted 4066
11 SASI_Hs01_00222063 predicted 1955
12 SASI_Hs01_00222064 predicted 957
13 SASI_Hs01_00222067 predicted 1815
14 SASI_Hs01_00222070 predicted 1816
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139027 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364079 predicted 4335
2 SASI_Hs01_00160898 predicted 745
3 SASI_Hs02_00364080 predicted 2141
4 SASI_Hs01_00160901 predicted 960
5 SASI_Hs01_00160902 predicted 2147
6 SASI_Hs02_00364081 predicted 4048
7 SASI_Hs01_00160904 predicted 917
8 SASI_Hs01_00160905 predicted 1770
9 SASI_Hs01_00160907 predicted 3173
10 SASI_Hs02_00364082 predicted 4159
11 SASI_Hs01_00160899 predicted 2044
12 SASI_Hs01_00160900 predicted 955
13 SASI_Hs01_00160903 predicted 1904
14 SASI_Hs01_00160906 predicted 1905
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139028 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062045 predicted 745
2 SASI_Hs01_00062046 predicted 957
3 SASI_Hs01_00062047 predicted 965
4 SASI_Hs01_00062048 predicted 918
5 SASI_Hs01_00062049 predicted 987
6 SASI_Hs01_00062050 predicted 1373
7 SASI_Hs01_00062051 predicted 1848
8 SASI_Hs01_00062052 predicted 1697
9 SASI_Hs01_00062053 predicted 979
10 SASI_Hs01_00062054 predicted 1098
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078796 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00362020 predicted 1443
2 SASI_Rn02_00362021 predicted 417
3 SASI_Rn02_00362022 predicted 1712
4 SASI_Rn02_00362023 predicted 1896
5 SASI_Rn02_00362024 predicted 3152
6 SASI_Rn02_00362025 predicted 2800
7 SASI_Rn02_00362026 predicted 2745
8 SASI_Rn02_00362027 predicted 410
9 SASI_Rn02_00362028 predicted 4081
10 SASI_Rn02_00362029 predicted 4076
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342395 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394217 predicted 1446
2 SASI_Rn02_00394218 predicted 417
3 SASI_Rn02_00394219 predicted 1715
4 SASI_Rn02_00394220 predicted 1895
5 SASI_Rn02_00394221 predicted 3154
6 SASI_Rn02_00394222 predicted 2801
7 SASI_Rn02_00394223 predicted 2748
8 SASI_Rn02_00394224 predicted 415
9 SASI_Rn02_00394225 predicted 4087
10 SASI_Rn02_00394226 predicted 4071
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001322 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102024 predicted 1458
2 SASI_Mm01_00102025 predicted 1199
3 SASI_Mm01_00102026 predicted 1309
4 SASI_Mm01_00102027 predicted 2608
5 SASI_Mm01_00102028 predicted 537
6 SASI_Mm01_00102029 predicted 1835
7 SASI_Mm01_00102030 predicted 2042
8 SASI_Mm01_00102031 predicted 1000
9 SASI_Mm01_00102032 predicted 538
10 SASI_Mm01_00102033 predicted 816
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139025
ADAMTS13 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 13
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139025.3-4656s21c1
Sequence:CCGGGTACTGGACCCTCCAATCATGCTCGAGCATGATTGGAGGGTCCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139025.3-2180s21c1
Sequence:CCGGACCTGACCAGTGTCTACATTGCTCGAGCAATGTAGACACTGGTCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139025.3-4717s21c1
Sequence:CCGGGAAGGAACCTGAGGGTCATTGCTCGAGCAATGACCCTCAGGTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139025.1-2143s1c1
Sequence:CCGGGCGAGAGAATATGTCACATTTCTCGAGAAATGTGACATATTCTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139025.1-4038s1c1
Sequence:CCGGGCCAACAGGAACCATTGACATCTCGAGATGTCAATGGTTCCTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139025.1-967s1c1
Sequence:CCGGGTCCTCTATATCACTAGGTTTCTCGAGAAACCTAGTGATATAGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139025.1-4318s1c1
Sequence:CCGGCCTGAAACCTTCTACAGAGAACTCGAGTTCTCTGTAGAAGGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139025.1-2023s1c1
Sequence:CCGGTGCAGGACATTTGGCTGTGATCTCGAGATCACAGCCAAATGTCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139025
ADAMTS13 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 13
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139025.3-4656s21c1
Sequence:CCGGGTACTGGACCCTCCAATCATGCTCGAGCATGATTGGAGGGTCCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139025.3-2180s21c1
Sequence:CCGGACCTGACCAGTGTCTACATTGCTCGAGCAATGTAGACACTGGTCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139025.3-4717s21c1
Sequence:CCGGGAAGGAACCTGAGGGTCATTGCTCGAGCAATGACCCTCAGGTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139025.1-2143s1c1
Sequence:CCGGGCGAGAGAATATGTCACATTTCTCGAGAAATGTGACATATTCTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139025.1-4038s1c1
Sequence:CCGGGCCAACAGGAACCATTGACATCTCGAGATGTCAATGGTTCCTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139025.1-967s1c1
Sequence:CCGGGTCCTCTATATCACTAGGTTTCTCGAGAAACCTAGTGATATAGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139025.1-4318s1c1
Sequence:CCGGCCTGAAACCTTCTACAGAGAACTCGAGTTCTCTGTAGAAGGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139025.1-2023s1c1
Sequence:CCGGTGCAGGACATTTGGCTGTGATCTCGAGATCACAGCCAAATGTCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139025
ADAMTS13 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 13
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139025.3-4656s21c1
Sequence:CCGGGTACTGGACCCTCCAATCATGCTCGAGCATGATTGGAGGGTCCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139025.3-2180s21c1
Sequence:CCGGACCTGACCAGTGTCTACATTGCTCGAGCAATGTAGACACTGGTCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139025.3-4717s21c1
Sequence:CCGGGAAGGAACCTGAGGGTCATTGCTCGAGCAATGACCCTCAGGTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139025.1-2143s1c1
Sequence:CCGGGCGAGAGAATATGTCACATTTCTCGAGAAATGTGACATATTCTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139025.1-4038s1c1
Sequence:CCGGGCCAACAGGAACCATTGACATCTCGAGATGTCAATGGTTCCTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139025.1-967s1c1
Sequence:CCGGGTCCTCTATATCACTAGGTTTCTCGAGAAACCTAGTGATATAGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139025.1-4318s1c1
Sequence:CCGGCCTGAAACCTTCTACAGAGAACTCGAGTTCTCTGTAGAAGGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139025.1-2023s1c1
Sequence:CCGGTGCAGGACATTTGGCTGTGATCTCGAGATCACAGCCAAATGTCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_205053
ADAMTS13 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 13
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_205053.3-4411s1c1
Sequence:CCGGGTATGCAACTTTAGCCTCTTTCTCGAGAAAGAGGCTAAAGTTGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205053.3-1894s1c1
Sequence:CCGGCCTTGTACTTAGCCACTGATTCTCGAGAATCAGTGGCTAAGTACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205053.3-3278s1c1
Sequence:CCGGCAATGAGGTGAATGAAACTTTCTCGAGAAAGTTTCATTCACCTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205053.3-1893s1c1
Sequence:CCGGTCCTTGTACTTAGCCACTGATCTCGAGATCAGTGGCTAAGTACAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205053.3-267s1c1
Sequence:CCGGAGAAGGACTTTGGAGGACATTCTCGAGAATGTCCTCCAAAGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_205053
ADAMTS13 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 13
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_205053.3-4411s1c1
Sequence:CCGGGTATGCAACTTTAGCCTCTTTCTCGAGAAAGAGGCTAAAGTTGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205053.3-1894s1c1
Sequence:CCGGCCTTGTACTTAGCCACTGATTCTCGAGAATCAGTGGCTAAGTACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205053.3-3278s1c1
Sequence:CCGGCAATGAGGTGAATGAAACTTTCTCGAGAAAGTTTCATTCACCTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205053.3-1893s1c1
Sequence:CCGGTCCTTGTACTTAGCCACTGATCTCGAGATCAGTGGCTAAGTACAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205053.3-267s1c1
Sequence:CCGGAGAAGGACTTTGGAGGACATTCTCGAGAATGTCCTCCAAAGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_205053
ADAMTS13 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 13
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_205053.3-4411s1c1
Sequence:CCGGGTATGCAACTTTAGCCTCTTTCTCGAGAAAGAGGCTAAAGTTGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205053.3-1894s1c1
Sequence:CCGGCCTTGTACTTAGCCACTGATTCTCGAGAATCAGTGGCTAAGTACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205053.3-3278s1c1
Sequence:CCGGCAATGAGGTGAATGAAACTTTCTCGAGAAAGTTTCATTCACCTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205053.3-1893s1c1
Sequence:CCGGTCCTTGTACTTAGCCACTGATCTCGAGATCAGTGGCTAAGTACAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205053.3-267s1c1
Sequence:CCGGAGAAGGACTTTGGAGGACATTCTCGAGAATGTCCTCCAAAGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks