EMAIL THIS PAGE TO A FRIEND

ADAMTS14

ADAM metallopeptidase with thrombospondin type 1 motif, 14

145 Gene Product Result for
UniProtKB ID: Q8WXS8, Q5T4G0, Q5T4G1, Q8TE55, Q8TEY8
Gene ID:
Human(140766) Summary: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. This gene is highly similar to two family members, ADAMTS2 and ADAMTS3, in its sequence and gene structure, and the encoded protein shares the aminoprocollagen peptidase activity with the protein products encoded by ADAMTS2 and ADAMTS3. Various transcript variants of this gene have been identified. They result from the use of two different promoters and transcription initiation sites as well as alternative splicing sites. The full length nature of some transcripts has not been defined. [provided by RefSeq, Jul 2008]
Mouse(237360) a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 14
Rat(309837) ADAM metallopeptidase with thrombospondin type 1 motif, 14
sheep(101106305) ADAM metallopeptidase with thrombospondin type 1 motif, 14
naked mole-rat(101718197) ADAM metallopeptidase with thrombospondin type 1 motif, 14
domestic guinea pig(100722001) ADAM metallopeptidase with thrombospondin type 1 motif, 14
chicken(423712) ADAM metallopeptidase with thrombospondin type 1 motif, 14
dog(489031) ADAM metallopeptidase with thrombospondin type 1 motif, 14
Horse(100063487) ADAM metallopeptidase with thrombospondin type 1 motif, 14
cow(510214) ADAM metallopeptidase with thrombospondin type 1 motif, 14
domestic cat(101100418) ADAM metallopeptidase with thrombospondin type 1 motif, 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080722 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080722 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080722 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_137117 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_137117 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_137117 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080722 Rosetta Predictions human pricing
NM_139155 Rosetta Predictions human pricing
NM_001107636 Rosetta Predictions rat pricing
NM_001081127 Rosetta Predictions mouse pricing
XM_137117 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080722 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087500 predicted 312
2 SASI_Hs02_00362496 predicted 1534
3 SASI_Hs01_00087503 predicted 2507
4 SASI_Hs02_00362497 predicted 3947
5 SASI_Hs02_00362498 predicted 2082
6 SASI_Hs02_00362499 predicted 3736
7 SASI_Hs02_00362500 predicted 855
8 SASI_Hs02_00362501 predicted 3695
9 SASI_Hs01_00087507 predicted 2542
10 SASI_Hs02_00362502 predicted 2219
11 SASI_Hs01_00087499 predicted 1541
12 SASI_Hs01_00087501 predicted 544
13 SASI_Hs01_00087502 predicted 832
14 SASI_Hs01_00087504 predicted 2320
15 SASI_Hs01_00087505 predicted 1409
16 SASI_Hs01_00087506 predicted 435
17 SASI_Hs01_00087508 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139155 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220207 predicted 308
2 SASI_Hs02_00364157 predicted 1537
3 SASI_Hs01_00220210 predicted 2521
4 SASI_Hs02_00364158 predicted 3958
5 SASI_Hs02_00364159 predicted 2095
6 SASI_Hs02_00364160 predicted 3752
7 SASI_Hs02_00364161 predicted 860
8 SASI_Hs02_00364162 predicted 3698
9 SASI_Hs01_00220214 predicted 2543
10 SASI_Hs02_00364163 predicted 2232
11 SASI_Hs01_00220206 predicted 1543
12 SASI_Hs01_00220208 predicted 540
13 SASI_Hs01_00220209 predicted 830
14 SASI_Hs01_00220211 predicted 2329
15 SASI_Hs01_00220212 predicted 1410
16 SASI_Hs01_00220213 predicted 435
17 SASI_Hs01_00220215 predicted 422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107636 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230785 predicted 254
2 SASI_Rn02_00230786 predicted 3123
3 SASI_Rn02_00230787 predicted 2466
4 SASI_Rn02_00230788 predicted 2049
5 SASI_Rn02_00230789 predicted 818
6 SASI_Rn02_00230790 predicted 1400
7 SASI_Rn02_00230791 predicted 2407
8 SASI_Rn02_00230792 predicted 1878
9 SASI_Rn02_00230793 predicted 646
10 SASI_Rn02_00230794 predicted 1805
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081127 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295451 predicted 1846
2 SASI_Mm02_00295452 predicted 468
3 SASI_Mm02_00295453 predicted 3601
4 SASI_Mm02_00295454 predicted 3415
5 SASI_Mm02_00295455 predicted 2345
6 SASI_Mm02_00295456 predicted 1763
7 SASI_Mm02_00295457 predicted 1270
8 SASI_Mm02_00295458 predicted 2123
9 SASI_Mm02_00295459 predicted 1287
10 SASI_Mm02_00295460 predicted 2246
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_137117 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00278638 predicted 1846
2 SASI_Mm01_00278639 predicted 1028
3 SASI_Mm01_00278640 predicted 1770
4 SASI_Mm01_00278641 predicted 1277
5 SASI_Mm01_00278642 predicted 1296
6 SASI_Mm01_00278643 predicted 2246
7 SASI_Mm01_00278644 predicted 2071
8 SASI_Mm01_00278645 predicted 618
9 SASI_Mm01_00278646 predicted 697
10 SASI_Mm01_00278647 predicted 3664
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080722
ADAMTS14 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 14
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080722.2-664s1c1
Sequence:CCGGGACCTGCACAATGAAGCCTTTCTCGAGAAAGGCTTCATTGTGCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080722.2-2463s1c1
Sequence:CCGGCCTGGCCTACAAGTACGTCATCTCGAGATGACGTACTTGTAGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080722.2-3060s1c1
Sequence:CCGGCTGTGGAGGAAATCACCAGAACTCGAGTTCTGGTGATTTCCTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080722.2-1477s1c1
Sequence:CCGGTGCTTGGCATTCAGGACCTTTCTCGAGAAAGGTCCTGAATGCCAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080722.2-317s1c1
Sequence:CCGGTCTACTTCAATGTCACTGTTTCTCGAGAAACAGTGACATTGAAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080722.3-2596s21c1
Sequence:CCGGGGGATCCAGTTCACCAAATACCTCGAGGTATTTGGTGAACTGGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415803    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080722.3-3861s21c1
Sequence:CCGGGAAAGCCCTAATCGGAGATACCTCGAGGTATCTCCGATTAGGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080722.3-2501s21c1
Sequence:CCGGCCCTTATCGGGAGCAACAATGCTCGAGCATTGTTGCTCCCGATAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080722
ADAMTS14 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 14
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080722.2-664s1c1
Sequence:CCGGGACCTGCACAATGAAGCCTTTCTCGAGAAAGGCTTCATTGTGCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080722.2-2463s1c1
Sequence:CCGGCCTGGCCTACAAGTACGTCATCTCGAGATGACGTACTTGTAGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080722.2-3060s1c1
Sequence:CCGGCTGTGGAGGAAATCACCAGAACTCGAGTTCTGGTGATTTCCTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080722.2-1477s1c1
Sequence:CCGGTGCTTGGCATTCAGGACCTTTCTCGAGAAAGGTCCTGAATGCCAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080722.2-317s1c1
Sequence:CCGGTCTACTTCAATGTCACTGTTTCTCGAGAAACAGTGACATTGAAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080722.3-2596s21c1
Sequence:CCGGGGGATCCAGTTCACCAAATACCTCGAGGTATTTGGTGAACTGGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415803    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080722.3-3861s21c1
Sequence:CCGGGAAAGCCCTAATCGGAGATACCTCGAGGTATCTCCGATTAGGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080722.3-2501s21c1
Sequence:CCGGCCCTTATCGGGAGCAACAATGCTCGAGCATTGTTGCTCCCGATAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080722
ADAMTS14 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 14
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080722.2-664s1c1
Sequence:CCGGGACCTGCACAATGAAGCCTTTCTCGAGAAAGGCTTCATTGTGCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080722.2-2463s1c1
Sequence:CCGGCCTGGCCTACAAGTACGTCATCTCGAGATGACGTACTTGTAGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080722.2-3060s1c1
Sequence:CCGGCTGTGGAGGAAATCACCAGAACTCGAGTTCTGGTGATTTCCTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080722.2-1477s1c1
Sequence:CCGGTGCTTGGCATTCAGGACCTTTCTCGAGAAAGGTCCTGAATGCCAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080722.2-317s1c1
Sequence:CCGGTCTACTTCAATGTCACTGTTTCTCGAGAAACAGTGACATTGAAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080722.3-2596s21c1
Sequence:CCGGGGGATCCAGTTCACCAAATACCTCGAGGTATTTGGTGAACTGGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415803    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080722.3-3861s21c1
Sequence:CCGGGAAAGCCCTAATCGGAGATACCTCGAGGTATCTCCGATTAGGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080722.3-2501s21c1
Sequence:CCGGCCCTTATCGGGAGCAACAATGCTCGAGCATTGTTGCTCCCGATAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_137117
ADAMTS14 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 14
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137117.5-2145s1c1
Sequence:CCGGGCCAAGCGAAACTCCTACTATCTCGAGATAGTAGGAGTTTCGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137117.5-2262s1c1
Sequence:CCGGGTGGTATTTATGAACCAAGTACTCGAGTACTTGGTTCATAAATACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137117.5-1053s1c1
Sequence:CCGGGACCTTCACAACGAAGCCTTTCTCGAGAAAGGCTTCGTTGTGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137117.5-2757s1c1
Sequence:CCGGGCCTACAAGTACGTCATCCATCTCGAGATGGATGACGTACTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137117.5-294s1c1
Sequence:CCGGTCTGGGAAACTTCACGACTATCTCGAGATAGTCGTGAAGTTTCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_137117
ADAMTS14 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 14
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137117.5-2145s1c1
Sequence:CCGGGCCAAGCGAAACTCCTACTATCTCGAGATAGTAGGAGTTTCGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137117.5-2262s1c1
Sequence:CCGGGTGGTATTTATGAACCAAGTACTCGAGTACTTGGTTCATAAATACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137117.5-1053s1c1
Sequence:CCGGGACCTTCACAACGAAGCCTTTCTCGAGAAAGGCTTCGTTGTGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137117.5-2757s1c1
Sequence:CCGGGCCTACAAGTACGTCATCCATCTCGAGATGGATGACGTACTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137117.5-294s1c1
Sequence:CCGGTCTGGGAAACTTCACGACTATCTCGAGATAGTCGTGAAGTTTCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_137117
ADAMTS14 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 14
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137117.5-2145s1c1
Sequence:CCGGGCCAAGCGAAACTCCTACTATCTCGAGATAGTAGGAGTTTCGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137117.5-2262s1c1
Sequence:CCGGGTGGTATTTATGAACCAAGTACTCGAGTACTTGGTTCATAAATACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137117.5-1053s1c1
Sequence:CCGGGACCTTCACAACGAAGCCTTTCTCGAGAAAGGCTTCGTTGTGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137117.5-2757s1c1
Sequence:CCGGGCCTACAAGTACGTCATCCATCTCGAGATGGATGACGTACTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137117.5-294s1c1
Sequence:CCGGTCTGGGAAACTTCACGACTATCTCGAGATAGTCGTGAAGTTTCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks