EMAIL THIS PAGE TO A FRIEND

ADAMTS15

ADAM metallopeptidase with thrombospondin type 1 motif, 15

55 Gene Product Result for
UniProtKB ID: Q8TE58, Q32MI6
Gene ID:
Human(170689) Summary: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The protein encoded by this gene has a high sequence similarity to the proteins encoded by ADAMTS1 and ADAMTS8. [provided by RefSeq, Jul 2008]
Mouse(235130) a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 15
Rat(300474) ADAM metallopeptidase with thrombospondin type 1 motif, 15
Zebrafish(100001991) ADAM metallopeptidase with thrombospondin type 1 motif, 15
dog(489275) ADAM metallopeptidase with thrombospondin type 1 motif, 15
cow(514927) ADAM metallopeptidase with thrombospondin type 1 motif, 15
Horse(100064739) ADAM metallopeptidase with thrombospondin type 1 motif, 15
domestic cat(101093887) ADAM metallopeptidase with thrombospondin type 1 motif, 15
chicken(419733) ADAM metallopeptidase with thrombospondin type 1 motif, 15
domestic guinea pig(100716089) ADAM metallopeptidase with thrombospondin type 1 motif, 15
naked mole-rat(101700248) ADAM metallopeptidase with thrombospondin type 1 motif, 15
sheep(101120284) ADAM metallopeptidase with thrombospondin type 1 motif, 15
Domestic Rabbit(100343187) ADAM metallopeptidase with thrombospondin type 1 motif, 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139055 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139055 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139055 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_134720 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_134720 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_134720 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139055 Rosetta Predictions human pricing
NM_001106810 Rosetta Predictions rat pricing
NM_001024139 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139055 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364107 predicted 394
2 SASI_Hs01_00218169 predicted 1360
3 SASI_Hs01_00218170 predicted 1255
4 SASI_Hs01_00218171 predicted 1552
5 SASI_Hs01_00218172 predicted 1055
6 SASI_Hs01_00218173 predicted 1034
7 SASI_Hs01_00218174 predicted 376
8 SASI_Hs01_00218177 predicted 798
9 SASI_Hs01_00218178 predicted 1419
10 SASI_Hs02_00364108 predicted 1104
11 SASI_Hs01_00218175 predicted 1995
12 SASI_Hs01_00218176 predicted 2046
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106810 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222628 predicted 1684
2 SASI_Rn02_00222629 predicted 1684
3 SASI_Rn02_00222630 predicted 2152
4 SASI_Rn02_00222631 predicted 1688
5 SASI_Rn02_00222632 predicted 2703
6 SASI_Rn02_00222633 predicted 3181
7 SASI_Rn02_00222634 predicted 1993
8 SASI_Rn02_00222635 predicted 2391
9 SASI_Rn02_00222636 predicted 2083
10 SASI_Rn02_00222637 predicted 2087
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024139 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189344 predicted 1573
2 SASI_Mm02_00287563 predicted 1965
3 SASI_Mm01_00189345 predicted 1573
4 SASI_Mm01_00189346 predicted 2049
5 SASI_Mm01_00189348 predicted 1880
6 SASI_Mm01_00189349 predicted 3027
7 SASI_Mm01_00189350 predicted 2285
8 SASI_Mm01_00189351 predicted 2190
9 SASI_Mm01_00189352 predicted 3079
10 SASI_Mm01_00189353 predicted 2250
11 SASI_Mm01_00189347 predicted 1589
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139055
ADAMTS15 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 15
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139055.1-628s21c1
Sequence:CCGGGCCAAGCGTTTCGTGTCTATCCTCGAGGATAGACACGAAACGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139055.1-2073s21c1
Sequence:CCGGGCCCATGCATGGCTACAATTTCTCGAGAAATTGTAGCCATGCATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139055.1-1544s21c1
Sequence:CCGGTGGATGGTTCCTGGGCCAAATCTCGAGATTTGGCCCAGGAACCATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139055.1-172s1c1
Sequence:CCGGACAGCATTTCAGGAGGACTTTCTCGAGAAAGTCCTCCTGAAATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139055.1-807s1c1
Sequence:CCGGGCTGCTTCTTAGAGATCGTGACTCGAGTCACGATCTCTAAGAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139055.1-1371s1c1
Sequence:CCGGGCCCTGTCCTTACATGCAGTACTCGAGTACTGCATGTAAGGACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139055.1-1992s1c1
Sequence:CCGGCTCCAAGAAGAGATTCGACAACTCGAGTTGTCGAATCTCTTCTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139055.1-2139s1c1
Sequence:CCGGGCGCGGTTACAAAGGGCTGATCTCGAGATCAGCCCTTTGTAACCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139055
ADAMTS15 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 15
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139055.1-628s21c1
Sequence:CCGGGCCAAGCGTTTCGTGTCTATCCTCGAGGATAGACACGAAACGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139055.1-2073s21c1
Sequence:CCGGGCCCATGCATGGCTACAATTTCTCGAGAAATTGTAGCCATGCATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139055.1-1544s21c1
Sequence:CCGGTGGATGGTTCCTGGGCCAAATCTCGAGATTTGGCCCAGGAACCATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139055.1-172s1c1
Sequence:CCGGACAGCATTTCAGGAGGACTTTCTCGAGAAAGTCCTCCTGAAATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139055.1-807s1c1
Sequence:CCGGGCTGCTTCTTAGAGATCGTGACTCGAGTCACGATCTCTAAGAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139055.1-1371s1c1
Sequence:CCGGGCCCTGTCCTTACATGCAGTACTCGAGTACTGCATGTAAGGACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139055.1-1992s1c1
Sequence:CCGGCTCCAAGAAGAGATTCGACAACTCGAGTTGTCGAATCTCTTCTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139055.1-2139s1c1
Sequence:CCGGGCGCGGTTACAAAGGGCTGATCTCGAGATCAGCCCTTTGTAACCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139055
ADAMTS15 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 15
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139055.1-628s21c1
Sequence:CCGGGCCAAGCGTTTCGTGTCTATCCTCGAGGATAGACACGAAACGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139055.1-2073s21c1
Sequence:CCGGGCCCATGCATGGCTACAATTTCTCGAGAAATTGTAGCCATGCATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139055.1-1544s21c1
Sequence:CCGGTGGATGGTTCCTGGGCCAAATCTCGAGATTTGGCCCAGGAACCATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139055.1-172s1c1
Sequence:CCGGACAGCATTTCAGGAGGACTTTCTCGAGAAAGTCCTCCTGAAATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139055.1-807s1c1
Sequence:CCGGGCTGCTTCTTAGAGATCGTGACTCGAGTCACGATCTCTAAGAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139055.1-1371s1c1
Sequence:CCGGGCCCTGTCCTTACATGCAGTACTCGAGTACTGCATGTAAGGACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139055.1-1992s1c1
Sequence:CCGGCTCCAAGAAGAGATTCGACAACTCGAGTTGTCGAATCTCTTCTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139055.1-2139s1c1
Sequence:CCGGGCGCGGTTACAAAGGGCTGATCTCGAGATCAGCCCTTTGTAACCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_134720
ADAMTS15 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 15
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134720.5-1665s1c1
Sequence:CCGGCGAGGGAGTAAGAGTGAAATACTCGAGTATTTCACTCTTACTCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134720.5-894s1c1
Sequence:CCGGGCTGAACAAAGTGAGCGATAACTCGAGTTATCGCTCACTTTGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134720.5-2193s1c1
Sequence:CCGGCCAAGGCAAATACCTGCTCAACTCGAGTTGAGCAGGTATTTGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134720.5-1221s1c1
Sequence:CCGGCGCTGCCATTATTACTGACTTCTCGAGAAGTCAGTAATAATGGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134720.5-706s1c1
Sequence:CCGGGCGGATTTGGAACATTATCTACTCGAGTAGATAATGTTCCAAATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_134720
ADAMTS15 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 15
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134720.5-1665s1c1
Sequence:CCGGCGAGGGAGTAAGAGTGAAATACTCGAGTATTTCACTCTTACTCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134720.5-894s1c1
Sequence:CCGGGCTGAACAAAGTGAGCGATAACTCGAGTTATCGCTCACTTTGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134720.5-2193s1c1
Sequence:CCGGCCAAGGCAAATACCTGCTCAACTCGAGTTGAGCAGGTATTTGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134720.5-1221s1c1
Sequence:CCGGCGCTGCCATTATTACTGACTTCTCGAGAAGTCAGTAATAATGGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134720.5-706s1c1
Sequence:CCGGGCGGATTTGGAACATTATCTACTCGAGTAGATAATGTTCCAAATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_134720
ADAMTS15 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 15
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134720.5-1665s1c1
Sequence:CCGGCGAGGGAGTAAGAGTGAAATACTCGAGTATTTCACTCTTACTCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134720.5-894s1c1
Sequence:CCGGGCTGAACAAAGTGAGCGATAACTCGAGTTATCGCTCACTTTGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134720.5-2193s1c1
Sequence:CCGGCCAAGGCAAATACCTGCTCAACTCGAGTTGAGCAGGTATTTGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134720.5-1221s1c1
Sequence:CCGGCGCTGCCATTATTACTGACTTCTCGAGAAGTCAGTAATAATGGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134720.5-706s1c1
Sequence:CCGGGCGGATTTGGAACATTATCTACTCGAGTAGATAATGTTCCAAATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks