EMAIL THIS PAGE TO A FRIEND

ADAMTS16

ADAM metallopeptidase with thrombospondin type 1 motif, 16

Synonyms: ADAMTS16s
UniProtKB ID: Q8TE57, C6G490, Q8IVE2
Gene ID:
Human(170690) Summary: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The protein encoded by this gene has high sequence similarity to the protein encoded by ADAMTS18, another family member. [provided by RefSeq, Jul 2008]
Mouse(271127) a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 16
Rat(306664) ADAM metallopeptidase with thrombospondin type 1 motif, 16
Zebrafish(568792) ADAM metallopeptidase with thrombospondin type 1 motif, 16
domestic cat(101100110) ADAM metallopeptidase with thrombospondin type 1 motif, 16
cow(520133) ADAM metallopeptidase with thrombospondin type 1 motif, 16
Horse(100071544) ADAM metallopeptidase with thrombospondin type 1 motif, 16
dog(488061) ADAM metallopeptidase with thrombospondin type 1 motif, 16
sheep(101107994) ADAM metallopeptidase with thrombospondin type 1 motif, 16
Domestic Rabbit(100350371) ADAM metallopeptidase with thrombospondin type 1 motif, 16
naked mole-rat(101697449) ADAM metallopeptidase with thrombospondin type 1 motif, 16
domestic guinea pig(100712606) ADAM metallopeptidase with thrombospondin type 1 motif, 16
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301190 Anti-ADAMTS16 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172053 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172053 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172053 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_139056 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139056 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139056 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139056 Rosetta Predictions human pricing
NM_001107332 Rosetta Predictions rat pricing
NM_172053 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139056 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241901 predicted 2183
2 SASI_Hs01_00241903 predicted 2515
3 SASI_Hs01_00241904 predicted 1280
4 SASI_Hs01_00241905 predicted 2579
5 SASI_Hs01_00241906 predicted 1186
6 SASI_Hs02_00364109 predicted 3876
7 SASI_Hs01_00241910 predicted 502
8 SASI_Hs02_00364110 predicted 2161
9 SASI_Hs02_00364111 predicted 2111
10 SASI_Hs02_00364112 predicted 3402
11 SASI_Hs01_00241902 predicted 828
12 SASI_Hs01_00241907 predicted 1001
13 SASI_Hs01_00241908 predicted 2311
14 SASI_Hs01_00241909 predicted 1516
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107332 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227795 predicted 2289
2 SASI_Rn02_00227796 predicted 2908
3 SASI_Rn02_00227797 predicted 1817
4 SASI_Rn02_00227798 predicted 2485
5 SASI_Rn02_00227799 predicted 2950
6 SASI_Rn02_00227800 predicted 2614
7 SASI_Rn02_00227801 predicted 2395
8 SASI_Rn02_00227802 predicted 2159
9 SASI_Rn02_00227803 predicted 2598
10 SASI_Rn02_00227804 predicted 2270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172053 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179541 predicted 2294
2 SASI_Mm01_00179542 predicted 551
3 SASI_Mm01_00179543 predicted 1740
4 SASI_Mm01_00179544 predicted 2865
5 SASI_Mm01_00179545 predicted 1073
6 SASI_Mm01_00179546 predicted 1402
7 SASI_Mm01_00179548 predicted 805
8 SASI_Mm01_00179549 predicted 3594
9 SASI_Mm01_00179550 predicted 2603
10 SASI_Mm02_00343646 predicted 1606
11 SASI_Mm01_00179547 predicted 1332
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172053
ADAMTS16 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 16
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031609    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172053.1-3001s1c1
Sequence:CCGGGTGTCCTCCTTCTGGGATTATCTCGAGATAATCCCAGAAGGAGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172053.1-2582s1c1
Sequence:CCGGCGGAGCATTCACATCTACGAACTCGAGTTCGTAGATGTGAATGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172053.1-1120s1c1
Sequence:CCGGCCACAGAAATGAAGAGTTAAACTCGAGTTTAACTCTTCATTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172053.1-686s1c1
Sequence:CCGGCCACCAGAAGAGAACTGCTTTCTCGAGAAAGCAGTTCTCTTCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172053.1-1791s1c1
Sequence:CCGGCGGGACAGTTATACGATGCAACTCGAGTTGCATCGTATAACTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172053
ADAMTS16 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 16
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031609    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172053.1-3001s1c1
Sequence:CCGGGTGTCCTCCTTCTGGGATTATCTCGAGATAATCCCAGAAGGAGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172053.1-2582s1c1
Sequence:CCGGCGGAGCATTCACATCTACGAACTCGAGTTCGTAGATGTGAATGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172053.1-1120s1c1
Sequence:CCGGCCACAGAAATGAAGAGTTAAACTCGAGTTTAACTCTTCATTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172053.1-686s1c1
Sequence:CCGGCCACCAGAAGAGAACTGCTTTCTCGAGAAAGCAGTTCTCTTCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172053.1-1791s1c1
Sequence:CCGGCGGGACAGTTATACGATGCAACTCGAGTTGCATCGTATAACTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172053
ADAMTS16 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 16
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031609    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172053.1-3001s1c1
Sequence:CCGGGTGTCCTCCTTCTGGGATTATCTCGAGATAATCCCAGAAGGAGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172053.1-2582s1c1
Sequence:CCGGCGGAGCATTCACATCTACGAACTCGAGTTCGTAGATGTGAATGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172053.1-1120s1c1
Sequence:CCGGCCACAGAAATGAAGAGTTAAACTCGAGTTTAACTCTTCATTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172053.1-686s1c1
Sequence:CCGGCCACCAGAAGAGAACTGCTTTCTCGAGAAAGCAGTTCTCTTCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172053.1-1791s1c1
Sequence:CCGGCGGGACAGTTATACGATGCAACTCGAGTTGCATCGTATAACTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139056
ADAMTS16 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 16
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139056.1-1424s1c1
Sequence:CCGGGCCGCCAGTATCTACACAAATCTCGAGATTTGTGTAGATACTGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139056.1-1628s1c1
Sequence:CCGGGCCATCGTATTGGAAGGAAATCTCGAGATTTCCTTCCAATACGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139056.1-395s1c1
Sequence:CCGGGCACTAAGTCTGTGCAGACTTCTCGAGAAGTCTGCACAGACTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139056.1-2497s1c1
Sequence:CCGGCCAACCAACGAGACACTGATTCTCGAGAATCAGTGTCTCGTTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139056.1-1489s1c1
Sequence:CCGGCCTGTGAAGGAATACAAGTATCTCGAGATACTTGTATTCCTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139056.2-2587s21c1
Sequence:CCGGGACTACAGACGGTCCTATAATCTCGAGATTATAGGACCGTCTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139056.2-934s21c1
Sequence:CCGGATCTTGCCAGATGAGTATAAGCTCGAGCTTATACTCATCTGGCAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139056
ADAMTS16 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 16
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139056.1-1424s1c1
Sequence:CCGGGCCGCCAGTATCTACACAAATCTCGAGATTTGTGTAGATACTGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139056.1-1628s1c1
Sequence:CCGGGCCATCGTATTGGAAGGAAATCTCGAGATTTCCTTCCAATACGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139056.1-395s1c1
Sequence:CCGGGCACTAAGTCTGTGCAGACTTCTCGAGAAGTCTGCACAGACTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139056.1-2497s1c1
Sequence:CCGGCCAACCAACGAGACACTGATTCTCGAGAATCAGTGTCTCGTTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139056.1-1489s1c1
Sequence:CCGGCCTGTGAAGGAATACAAGTATCTCGAGATACTTGTATTCCTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139056.2-2587s21c1
Sequence:CCGGGACTACAGACGGTCCTATAATCTCGAGATTATAGGACCGTCTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139056.2-934s21c1
Sequence:CCGGATCTTGCCAGATGAGTATAAGCTCGAGCTTATACTCATCTGGCAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139056
ADAMTS16 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 16
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139056.1-1424s1c1
Sequence:CCGGGCCGCCAGTATCTACACAAATCTCGAGATTTGTGTAGATACTGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139056.1-1628s1c1
Sequence:CCGGGCCATCGTATTGGAAGGAAATCTCGAGATTTCCTTCCAATACGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139056.1-395s1c1
Sequence:CCGGGCACTAAGTCTGTGCAGACTTCTCGAGAAGTCTGCACAGACTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139056.1-2497s1c1
Sequence:CCGGCCAACCAACGAGACACTGATTCTCGAGAATCAGTGTCTCGTTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139056.1-1489s1c1
Sequence:CCGGCCTGTGAAGGAATACAAGTATCTCGAGATACTTGTATTCCTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139056.2-2587s21c1
Sequence:CCGGGACTACAGACGGTCCTATAATCTCGAGATTATAGGACCGTCTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139056.2-934s21c1
Sequence:CCGGATCTTGCCAGATGAGTATAAGCTCGAGCTTATACTCATCTGGCAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks