EMAIL THIS PAGE TO A FRIEND

ADAMTS17

ADAM metallopeptidase with thrombospondin type 1 motif, 17

129 Gene Product Result for
UniProtKB ID: Q8TE56, Q2I7G4, Q6ZN75
Gene ID:
Human(170691) Summary: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The protein encoded by this gene has a high sequence similarity to the protein encoded by ADAMTS19, another family member. The function of this protein has not been determined. [provided by RefSeq, Jul 2008]
Mouse(233332) a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 17
Rat(293004) ADAM metallopeptidase with thrombospondin type 1 motif, 17
domestic guinea pig(100715625) ADAM metallopeptidase with thrombospondin type 1 motif, 17
naked mole-rat(101703382) ADAM metallopeptidase with thrombospondin type 1 motif, 17
sheep(101110624) ADAM metallopeptidase with thrombospondin type 1 motif, 17
chicken(415515) ADAM metallopeptidase with thrombospondin type 1 motif, 17
domestic cat(101080540) ADAM metallopeptidase with thrombospondin type 1 motif, 17
dog(488708) ADAM metallopeptidase with thrombospondin type 1 motif, 17
cow(538131) ADAM metallopeptidase with thrombospondin type 1 motif, 17
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139057 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139057 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139057 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_133542 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_133542 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_133542 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139057 Rosetta Predictions human pricing
XM_001059825 Rosetta Predictions rat pricing
XM_218753 Rosetta Predictions rat pricing
NM_001033877 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139057 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028295 predicted 1536
2 SASI_Hs01_00028297 predicted 2426
3 SASI_Hs02_00364113 predicted 1531
4 SASI_Hs01_00028298 predicted 860
5 SASI_Hs01_00028299 predicted 2368
6 SASI_Hs01_00028300 predicted 849
7 SASI_Hs01_00028301 predicted 1257
8 SASI_Hs01_00028302 predicted 2391
9 SASI_Hs01_00028303 predicted 837
10 SASI_Hs01_00028304 predicted 1034
11 SASI_Hs01_00028296 predicted 2334
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059825 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00294469 predicted 2347
2 SASI_Rn02_00294470 predicted 811
3 SASI_Rn02_00294471 predicted 2541
4 SASI_Rn02_00294472 predicted 1600
5 SASI_Rn02_00294473 predicted 1547
6 SASI_Rn02_00294474 predicted 2525
7 SASI_Rn02_00294475 predicted 1522
8 SASI_Rn02_00294476 predicted 2547
9 SASI_Rn02_00294477 predicted 1357
10 SASI_Rn02_00294478 predicted 1401
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218753 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378042 predicted 579
2 SASI_Rn02_00378043 predicted 616
3 SASI_Rn02_00378044 predicted 546
4 SASI_Rn02_00378045 predicted 566
5 SASI_Rn02_00378046 predicted 307
6 SASI_Rn02_00378047 predicted 429
7 SASI_Rn02_00378048 predicted 507
8 SASI_Rn02_00378049 predicted 413
9 SASI_Rn02_00378050 predicted 195
10 SASI_Rn02_00378051 predicted 405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033877 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289020 predicted 2640
2 SASI_Mm02_00289021 predicted 2224
3 SASI_Mm01_00128379 predicted 1321
4 SASI_Mm01_00128381 predicted 1197
5 SASI_Mm01_00128382 predicted 1477
6 SASI_Mm01_00128383 predicted 1524
7 SASI_Mm01_00128384 predicted 961
8 SASI_Mm02_00289022 predicted 3013
9 SASI_Mm01_00128387 predicted 1232
10 SASI_Mm02_00289023 predicted 2675
11 SASI_Mm01_00128378 predicted 875
12 SASI_Mm01_00128380 predicted 1431
13 SASI_Mm01_00128385 predicted 1405
14 SASI_Mm01_00128386 predicted 1129
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139057
ADAMTS17 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 17
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139057.2-1030s21c1
Sequence:CCGGAGCGCGATACCTCGGCAATAACTCGAGTTATTGCCGAGGTATCGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139057.2-3512s21c1
Sequence:CCGGCATTAGTGCTTCCGTACTTAACTCGAGTTAAGTACGGAAGCACTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139057.2-610s21c1
Sequence:CCGGACATCTGATCAGGCGCAAATGCTCGAGCATTTGCGCCTGATCAGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139057.1-1128s1c1
Sequence:CCGGGCTAAGAGGAAGTGTGTGCTTCTCGAGAAGCACACACTTCCTCTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005137    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139057.1-3316s1c1
Sequence:CCGGCAGTCCCAAGGGTCGCTCAAACTCGAGTTTGAGCGACCCTTGGGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139057.1-2866s1c1
Sequence:CCGGGCACCAACTCACAAGGGAAATCTCGAGATTTCCCTTGTGAGTTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139057.1-2319s1c1
Sequence:CCGGGTGTTGTTATTTCACGACCAACTCGAGTTGGTCGTGAAATAACAACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139057.1-1483s1c1
Sequence:CCGGGCAGAAACATGGAGCATCTAACTCGAGTTAGATGCTCCATGTTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139057
ADAMTS17 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 17
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139057.2-1030s21c1
Sequence:CCGGAGCGCGATACCTCGGCAATAACTCGAGTTATTGCCGAGGTATCGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139057.2-3512s21c1
Sequence:CCGGCATTAGTGCTTCCGTACTTAACTCGAGTTAAGTACGGAAGCACTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139057.2-610s21c1
Sequence:CCGGACATCTGATCAGGCGCAAATGCTCGAGCATTTGCGCCTGATCAGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139057.1-1128s1c1
Sequence:CCGGGCTAAGAGGAAGTGTGTGCTTCTCGAGAAGCACACACTTCCTCTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005137    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139057.1-3316s1c1
Sequence:CCGGCAGTCCCAAGGGTCGCTCAAACTCGAGTTTGAGCGACCCTTGGGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139057.1-2866s1c1
Sequence:CCGGGCACCAACTCACAAGGGAAATCTCGAGATTTCCCTTGTGAGTTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139057.1-2319s1c1
Sequence:CCGGGTGTTGTTATTTCACGACCAACTCGAGTTGGTCGTGAAATAACAACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139057.1-1483s1c1
Sequence:CCGGGCAGAAACATGGAGCATCTAACTCGAGTTAGATGCTCCATGTTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139057
ADAMTS17 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 17
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139057.2-1030s21c1
Sequence:CCGGAGCGCGATACCTCGGCAATAACTCGAGTTATTGCCGAGGTATCGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139057.2-3512s21c1
Sequence:CCGGCATTAGTGCTTCCGTACTTAACTCGAGTTAAGTACGGAAGCACTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139057.2-610s21c1
Sequence:CCGGACATCTGATCAGGCGCAAATGCTCGAGCATTTGCGCCTGATCAGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139057.1-1128s1c1
Sequence:CCGGGCTAAGAGGAAGTGTGTGCTTCTCGAGAAGCACACACTTCCTCTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005137    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139057.1-3316s1c1
Sequence:CCGGCAGTCCCAAGGGTCGCTCAAACTCGAGTTTGAGCGACCCTTGGGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139057.1-2866s1c1
Sequence:CCGGGCACCAACTCACAAGGGAAATCTCGAGATTTCCCTTGTGAGTTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139057.1-2319s1c1
Sequence:CCGGGTGTTGTTATTTCACGACCAACTCGAGTTGGTCGTGAAATAACAACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139057.1-1483s1c1
Sequence:CCGGGCAGAAACATGGAGCATCTAACTCGAGTTAGATGCTCCATGTTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_133542
ADAMTS17 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 17
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133542.4-694s1c1
Sequence:CCGGCGCTGCAAAGTAGTGACAGAACTCGAGTTCTGTCACTACTTTGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133542.4-2472s1c1
Sequence:CCGGGCTGTTATTTCATGACCAGAACTCGAGTTCTGGTCATGAAATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133542.4-625s1c1
Sequence:CCGGGAGCATCTGATCAGACGCAAACTCGAGTTTGCGTCTGATCAGATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133542.4-1966s1c1
Sequence:CCGGGCAGTGGTGGTTGATGATAAACTCGAGTTTATCATCAACCACCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133542.4-1136s1c1
Sequence:CCGGGCGTTCACAAAGATGAACCTTCTCGAGAAGGTTCATCTTTGTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_133542
ADAMTS17 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 17
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133542.4-694s1c1
Sequence:CCGGCGCTGCAAAGTAGTGACAGAACTCGAGTTCTGTCACTACTTTGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133542.4-2472s1c1
Sequence:CCGGGCTGTTATTTCATGACCAGAACTCGAGTTCTGGTCATGAAATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133542.4-625s1c1
Sequence:CCGGGAGCATCTGATCAGACGCAAACTCGAGTTTGCGTCTGATCAGATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133542.4-1966s1c1
Sequence:CCGGGCAGTGGTGGTTGATGATAAACTCGAGTTTATCATCAACCACCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133542.4-1136s1c1
Sequence:CCGGGCGTTCACAAAGATGAACCTTCTCGAGAAGGTTCATCTTTGTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_133542
ADAMTS17 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 17
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133542.4-694s1c1
Sequence:CCGGCGCTGCAAAGTAGTGACAGAACTCGAGTTCTGTCACTACTTTGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133542.4-2472s1c1
Sequence:CCGGGCTGTTATTTCATGACCAGAACTCGAGTTCTGGTCATGAAATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133542.4-625s1c1
Sequence:CCGGGAGCATCTGATCAGACGCAAACTCGAGTTTGCGTCTGATCAGATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133542.4-1966s1c1
Sequence:CCGGGCAGTGGTGGTTGATGATAAACTCGAGTTTATCATCAACCACCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133542.4-1136s1c1
Sequence:CCGGGCGTTCACAAAGATGAACCTTCTCGAGAAGGTTCATCTTTGTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks