EMAIL THIS PAGE TO A FRIEND

ADAMTS18

ADAM metallopeptidase with thrombospondin type 1 motif, 18

Synonyms: ADAMTS21 KNO2
UniProtKB ID: Q8TE60, Q6P4R5, Q6ZWJ9
Gene ID:
Human(170692) Summary: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The protein encoded by this gene has a high sequence similarity to the protein encoded by gene ADAMTS16, another family member. It is thought to function as a tumor suppressor. Alternatively spliced transcript variants have been identified, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(208936) a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 18
Rat(361412) ADAM metallopeptidase with thrombospondin type 1 motif, 18
Zebrafish(100150128) ADAM metallopeptidase with thrombospondin type 1 motif, 18
cow(518395) ADAM metallopeptidase with thrombospondin type 1 motif, 18
Horse(100069320) ADAM metallopeptidase with thrombospondin type 1 motif, 18
domestic cat(101098595) ADAM metallopeptidase with thrombospondin type 1 motif, 18
dog(489704) ADAM metallopeptidase with thrombospondin type 1 motif, 18
chicken(100858277) ADAM metallopeptidase with thrombospondin type 1 motif, 18
sheep(101118979) ADAM metallopeptidase with thrombospondin type 1 motif, 18
Domestic Rabbit(100344817) ADAM metallopeptidase with thrombospondin type 1 motif, 18
naked mole-rat(101700867) ADAM metallopeptidase with thrombospondin type 1 motif, 18
domestic guinea pig(100723415) ADAM metallopeptidase with thrombospondin type 1 motif, 18
140 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172466 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172466 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172466 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_139054 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139054 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139054 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_199355 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199355 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199355 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU052631 MISSION® esiRNA esiRNA human ADAMTS18 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139054 Rosetta Predictions human pricing
NM_199355 Rosetta Predictions human pricing
XM_001078056 Rosetta Predictions rat pricing
XM_574244 Rosetta Predictions rat pricing
NM_172466 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139054 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065410 predicted 1911
2 SASI_Hs01_00065411 predicted 848
3 SASI_Hs01_00065412 predicted 3209
4 SASI_Hs01_00065413 predicted 729
5 SASI_Hs01_00065414 predicted 1921
6 SASI_Hs01_00065415 predicted 2980
7 SASI_Hs01_00065416 predicted 2873
8 SASI_Hs01_00065417 predicted 1945
9 SASI_Hs01_00065418 predicted 947
10 SASI_Hs01_00065419 predicted 641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199355 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372793 predicted 3779
2 SASI_Hs01_00140931 predicted 1911
3 SASI_Hs02_00372794 predicted 1475
4 SASI_Hs02_00372795 predicted 1412
5 SASI_Hs01_00140933 predicted 3208
6 SASI_Hs01_00140935 predicted 1919
7 SASI_Hs01_00140936 predicted 2969
8 SASI_Hs01_00140938 predicted 1936
9 SASI_Hs02_00372796 predicted 1573
10 SASI_Hs02_00372797 predicted 3997
11 SASI_Hs01_00140932 predicted 844
12 SASI_Hs01_00140934 predicted 725
13 SASI_Hs01_00140937 predicted 2872
14 SASI_Hs01_00140939 predicted 939
15 SASI_Hs01_00140940 predicted 641
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078056 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359527 predicted 642
2 SASI_Rn02_00359528 predicted 451
3 SASI_Rn02_00359529 predicted 1639
4 SASI_Rn02_00359530 predicted 1930
5 SASI_Rn02_00359531 predicted 2936
6 SASI_Rn02_00359532 predicted 1199
7 SASI_Rn02_00359533 predicted 1166
8 SASI_Rn02_00359534 predicted 2642
9 SASI_Rn02_00359535 predicted 1661
10 SASI_Rn02_00359536 predicted 1232
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574244 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401644 predicted 3359
2 SASI_Rn02_00401645 predicted 3015
3 SASI_Rn02_00401646 predicted 2512
4 SASI_Rn02_00401647 predicted 2936
5 SASI_Rn02_00401648 predicted 2862
6 SASI_Rn02_00401649 predicted 2642
7 SASI_Rn02_00401650 predicted 3597
8 SASI_Rn02_00401651 predicted 3632
9 SASI_Rn02_00401652 predicted 2490
10 SASI_Rn02_00401653 predicted 2608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172466 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344001 predicted 790
2 SASI_Mm01_00089777 predicted 3079
3 SASI_Mm02_00344002 predicted 667
4 SASI_Mm01_00089778 predicted 2871
5 SASI_Mm01_00089780 predicted 1165
6 SASI_Mm01_00089781 predicted 2584
7 SASI_Mm02_00344003 predicted 1861
8 SASI_Mm02_00344004 predicted 679
9 SASI_Mm01_00089784 predicted 3582
10 SASI_Mm01_00089785 predicted 1584
11 SASI_Mm01_00089779 predicted 1998
12 SASI_Mm01_00089782 predicted 2009
13 SASI_Mm01_00089783 predicted 2024
14 SASI_Mm01_00089786 predicted 2794
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172466
ADAMTS18 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 18
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172466.1-1908s1c1
Sequence:CCGGGCCGACAGTATCTAAAGAAATCTCGAGATTTCTTTAGATACTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172466.1-2925s1c1
Sequence:CCGGCCACGTTTGAATACCAGCGTTCTCGAGAACGCTGGTATTCAAACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172466.1-2430s1c1
Sequence:CCGGCCCAACAGTGTGCAGAGTATACTCGAGTATACTCTGCACACTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172466.1-3763s1c1
Sequence:CCGGCCGCAACATTAAGAAGGCCAACTCGAGTTGGCCTTCTTAATGTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172466.1-3241s1c1
Sequence:CCGGGCCCAAGATATGCAACGCTTTCTCGAGAAAGCGTTGCATATCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172466
ADAMTS18 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 18
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172466.1-1908s1c1
Sequence:CCGGGCCGACAGTATCTAAAGAAATCTCGAGATTTCTTTAGATACTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172466.1-2925s1c1
Sequence:CCGGCCACGTTTGAATACCAGCGTTCTCGAGAACGCTGGTATTCAAACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172466.1-2430s1c1
Sequence:CCGGCCCAACAGTGTGCAGAGTATACTCGAGTATACTCTGCACACTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172466.1-3763s1c1
Sequence:CCGGCCGCAACATTAAGAAGGCCAACTCGAGTTGGCCTTCTTAATGTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172466.1-3241s1c1
Sequence:CCGGGCCCAAGATATGCAACGCTTTCTCGAGAAAGCGTTGCATATCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172466
ADAMTS18 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 18
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172466.1-1908s1c1
Sequence:CCGGGCCGACAGTATCTAAAGAAATCTCGAGATTTCTTTAGATACTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172466.1-2925s1c1
Sequence:CCGGCCACGTTTGAATACCAGCGTTCTCGAGAACGCTGGTATTCAAACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172466.1-2430s1c1
Sequence:CCGGCCCAACAGTGTGCAGAGTATACTCGAGTATACTCTGCACACTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172466.1-3763s1c1
Sequence:CCGGCCGCAACATTAAGAAGGCCAACTCGAGTTGGCCTTCTTAATGTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172466.1-3241s1c1
Sequence:CCGGGCCCAAGATATGCAACGCTTTCTCGAGAAAGCGTTGCATATCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139054
ADAMTS18 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 18
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139054.2-1849s1c1
Sequence:CCGGGCCGCCAGTATCTCAAGAAATCTCGAGATTTCTTGAGATACTGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139054.2-3108s1c1
Sequence:CCGGGCCATTTGCTTGCGAGATCAACTCGAGTTGATCTCGCAAGCAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139054.2-2687s1c1
Sequence:CCGGCCAGCATAAAGCAAATGAATACTCGAGTATTCATTTGCTTTATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139054.2-1572s1c1
Sequence:CCGGGCCATCTTACTAACAGGATTTCTCGAGAAATCCTGTTAGTAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139054.2-580s1c1
Sequence:CCGGCCAGCGGATTAAATGATGATTCTCGAGAATCATCATTTAATCCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139054
ADAMTS18 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 18
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139054.2-1849s1c1
Sequence:CCGGGCCGCCAGTATCTCAAGAAATCTCGAGATTTCTTGAGATACTGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139054.2-3108s1c1
Sequence:CCGGGCCATTTGCTTGCGAGATCAACTCGAGTTGATCTCGCAAGCAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139054.2-2687s1c1
Sequence:CCGGCCAGCATAAAGCAAATGAATACTCGAGTATTCATTTGCTTTATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139054.2-1572s1c1
Sequence:CCGGGCCATCTTACTAACAGGATTTCTCGAGAAATCCTGTTAGTAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139054.2-580s1c1
Sequence:CCGGCCAGCGGATTAAATGATGATTCTCGAGAATCATCATTTAATCCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139054
ADAMTS18 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 18
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139054.2-1849s1c1
Sequence:CCGGGCCGCCAGTATCTCAAGAAATCTCGAGATTTCTTGAGATACTGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139054.2-3108s1c1
Sequence:CCGGGCCATTTGCTTGCGAGATCAACTCGAGTTGATCTCGCAAGCAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139054.2-2687s1c1
Sequence:CCGGCCAGCATAAAGCAAATGAATACTCGAGTATTCATTTGCTTTATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139054.2-1572s1c1
Sequence:CCGGGCCATCTTACTAACAGGATTTCTCGAGAAATCCTGTTAGTAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139054.2-580s1c1
Sequence:CCGGCCAGCGGATTAAATGATGATTCTCGAGAATCATCATTTAATCCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199355
ADAMTS18 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 18
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000377638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199355.2-3971s21c1
Sequence:CCGGGGATCCATCCTGCGTAGATTTCTCGAGAAATCTACGCAGGATGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199355.2-3696s21c1
Sequence:CCGGGAGCGAAGATGCCGTAATATTCTCGAGAATATTACGGCATCTTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199355
ADAMTS18 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 18
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000377638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199355.2-3971s21c1
Sequence:CCGGGGATCCATCCTGCGTAGATTTCTCGAGAAATCTACGCAGGATGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199355.2-3696s21c1
Sequence:CCGGGAGCGAAGATGCCGTAATATTCTCGAGAATATTACGGCATCTTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199355
ADAMTS18 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 18
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000377638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199355.2-3971s21c1
Sequence:CCGGGGATCCATCCTGCGTAGATTTCTCGAGAAATCTACGCAGGATGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199355.2-3696s21c1
Sequence:CCGGGAGCGAAGATGCCGTAATATTCTCGAGAATATTACGGCATCTTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks