EMAIL THIS PAGE TO A FRIEND

ADAMTS19

ADAM metallopeptidase with thrombospondin type 1 motif, 19

203 Gene Product Result for
UniProtKB ID: Q8TE59
Gene ID:
Human(171019) Summary: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The protein encoded by this gene has high sequence similarity to the protein encoded by ADAMTS16, another family member. [provided by RefSeq, Jul 2008]
Mouse(240322) a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 19
Rat(361332) ADAM metallopeptidase with thrombospondin type 1 motif, 19
domestic guinea pig(100713775) ADAM metallopeptidase with thrombospondin type 1 motif, 19
naked mole-rat(101702440) ADAM metallopeptidase with thrombospondin type 1 motif, 19
sheep(101102235) ADAM metallopeptidase with thrombospondin type 1 motif, 19
chicken(415600) ADAM metallopeptidase with thrombospondin type 1 motif, 19
dog(609332) ADAM metallopeptidase with thrombospondin type 1 motif, 19
cow(537961) ADAM metallopeptidase with thrombospondin type 1 motif, 19
domestic cat(101082622) ADAM metallopeptidase with thrombospondin type 1 motif, 19
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133638 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133638 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133638 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175506 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175506 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175506 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133638 Rosetta Predictions human pricing
NM_001108433 Rosetta Predictions rat pricing
NM_175506 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133638 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363273 predicted 2281
2 SASI_Hs01_00051498 predicted 1535
3 SASI_Hs01_00051499 predicted 2076
4 SASI_Hs01_00051500 predicted 2400
5 SASI_Hs02_00363274 predicted 2568
6 SASI_Hs02_00363275 predicted 1331
7 SASI_Hs01_00051502 predicted 3495
8 SASI_Hs02_00363276 predicted 1134
9 SASI_Hs01_00051505 predicted 2468
10 SASI_Hs01_00051506 predicted 1626
11 SASI_Hs01_00051501 predicted 1446
12 SASI_Hs01_00051503 predicted 2245
13 SASI_Hs01_00051504 predicted 2344
14 SASI_Hs01_00051507 predicted 1551
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108433 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238589 predicted 3056
2 SASI_Rn02_00238590 predicted 1974
3 SASI_Rn02_00238591 predicted 2942
4 SASI_Rn02_00238592 predicted 1749
5 SASI_Rn02_00238593 predicted 2841
6 SASI_Rn02_00238594 predicted 1409
7 SASI_Rn02_00238595 predicted 2752
8 SASI_Rn02_00238596 predicted 2132
9 SASI_Rn02_00238597 predicted 2792
10 SASI_Rn02_00238598 predicted 2558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175506 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046607 predicted 1802
2 SASI_Mm02_00346418 predicted 1500
3 SASI_Mm01_00046608 predicted 2549
4 SASI_Mm02_00346419 predicted 2526
5 SASI_Mm01_00046609 predicted 2294
6 SASI_Mm02_00346420 predicted 2074
7 SASI_Mm01_00046612 predicted 2701
8 SASI_Mm01_00046613 predicted 3289
9 SASI_Mm01_00046614 predicted 2136
10 SASI_Mm01_00046615 predicted 2610
11 SASI_Mm01_00046610 predicted 2771
12 SASI_Mm01_00046611 predicted 1421
13 SASI_Mm01_00046616 predicted 2958
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133638
ADAMTS19 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 19
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133638.3-3982s21c1
Sequence:CCGGGTATACTGACTTAGCATAATACTCGAGTATTATGCTAAGTCAGTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133638.3-872s21c1
Sequence:CCGGGTCATTACTGTGGTATCATTTCTCGAGAAATGATACCACAGTAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133638.3-2244s21c1
Sequence:CCGGTGGCTATCAGGGATTAGATATCTCGAGATATCTAATCCCTGATAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133638.1-2649s1c1
Sequence:CCGGGCTCCTGTTTCAGGATCAGAACTCGAGTTCTGATCCTGAAACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133638.1-2912s1c1
Sequence:CCGGGCAATGAGCAACCATGTCAAACTCGAGTTTGACATGGTTGCTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133638.1-3179s1c1
Sequence:CCGGCCGTTAGATGTACCAACCCAACTCGAGTTGGGTTGGTACATCTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133638.1-1104s1c1
Sequence:CCGGGCAGGTCAATCTTCGTGTGATCTCGAGATCACACGAAGATTGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133638.1-1574s1c1
Sequence:CCGGGCAAGGAAGATTTGGAAAGATCTCGAGATCTTTCCAAATCTTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133638
ADAMTS19 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 19
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133638.3-3982s21c1
Sequence:CCGGGTATACTGACTTAGCATAATACTCGAGTATTATGCTAAGTCAGTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133638.3-872s21c1
Sequence:CCGGGTCATTACTGTGGTATCATTTCTCGAGAAATGATACCACAGTAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133638.3-2244s21c1
Sequence:CCGGTGGCTATCAGGGATTAGATATCTCGAGATATCTAATCCCTGATAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133638.1-2649s1c1
Sequence:CCGGGCTCCTGTTTCAGGATCAGAACTCGAGTTCTGATCCTGAAACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133638.1-2912s1c1
Sequence:CCGGGCAATGAGCAACCATGTCAAACTCGAGTTTGACATGGTTGCTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133638.1-3179s1c1
Sequence:CCGGCCGTTAGATGTACCAACCCAACTCGAGTTGGGTTGGTACATCTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133638.1-1104s1c1
Sequence:CCGGGCAGGTCAATCTTCGTGTGATCTCGAGATCACACGAAGATTGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133638.1-1574s1c1
Sequence:CCGGGCAAGGAAGATTTGGAAAGATCTCGAGATCTTTCCAAATCTTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133638
ADAMTS19 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 19
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133638.3-3982s21c1
Sequence:CCGGGTATACTGACTTAGCATAATACTCGAGTATTATGCTAAGTCAGTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133638.3-872s21c1
Sequence:CCGGGTCATTACTGTGGTATCATTTCTCGAGAAATGATACCACAGTAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133638.3-2244s21c1
Sequence:CCGGTGGCTATCAGGGATTAGATATCTCGAGATATCTAATCCCTGATAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133638.1-2649s1c1
Sequence:CCGGGCTCCTGTTTCAGGATCAGAACTCGAGTTCTGATCCTGAAACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133638.1-2912s1c1
Sequence:CCGGGCAATGAGCAACCATGTCAAACTCGAGTTTGACATGGTTGCTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133638.1-3179s1c1
Sequence:CCGGCCGTTAGATGTACCAACCCAACTCGAGTTGGGTTGGTACATCTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133638.1-1104s1c1
Sequence:CCGGGCAGGTCAATCTTCGTGTGATCTCGAGATCACACGAAGATTGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133638.1-1574s1c1
Sequence:CCGGGCAAGGAAGATTTGGAAAGATCTCGAGATCTTTCCAAATCTTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175506
ADAMTS19 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 19
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175506.2-1005s1c1
Sequence:CCGGCCTACAAATTATCCCAGGAATCTCGAGATTCCTGGGATAATTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175506.2-859s1c1
Sequence:CCGGGCACCGTTTATACAGGCAGAACTCGAGTTCTGCCTGTATAAACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175506.2-1804s1c1
Sequence:CCGGGCATGTTATCTGCACTGGTTTCTCGAGAAACCAGTGCAGATAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175506.2-1545s1c1
Sequence:CCGGCCTGTGCTGATGGTCTTCATACTCGAGTATGAAGACCATCAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175506.2-3335s1c1
Sequence:CCGGGACTGGTCTAAGTGCTCCATTCTCGAGAATGGAGCACTTAGACCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175506
ADAMTS19 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 19
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175506.2-1005s1c1
Sequence:CCGGCCTACAAATTATCCCAGGAATCTCGAGATTCCTGGGATAATTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175506.2-859s1c1
Sequence:CCGGGCACCGTTTATACAGGCAGAACTCGAGTTCTGCCTGTATAAACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175506.2-1804s1c1
Sequence:CCGGGCATGTTATCTGCACTGGTTTCTCGAGAAACCAGTGCAGATAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175506.2-1545s1c1
Sequence:CCGGCCTGTGCTGATGGTCTTCATACTCGAGTATGAAGACCATCAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175506.2-3335s1c1
Sequence:CCGGGACTGGTCTAAGTGCTCCATTCTCGAGAATGGAGCACTTAGACCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175506
ADAMTS19 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 19
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175506.2-1005s1c1
Sequence:CCGGCCTACAAATTATCCCAGGAATCTCGAGATTCCTGGGATAATTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175506.2-859s1c1
Sequence:CCGGGCACCGTTTATACAGGCAGAACTCGAGTTCTGCCTGTATAAACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175506.2-1804s1c1
Sequence:CCGGGCATGTTATCTGCACTGGTTTCTCGAGAAACCAGTGCAGATAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175506.2-1545s1c1
Sequence:CCGGCCTGTGCTGATGGTCTTCATACTCGAGTATGAAGACCATCAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175506.2-3335s1c1
Sequence:CCGGGACTGGTCTAAGTGCTCCATTCTCGAGAATGGAGCACTTAGACCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks