EMAIL THIS PAGE TO A FRIEND

ADAMTS1

ADAM metallopeptidase with thrombospondin type 1 motif, 1

99 Gene Product Result for
Synonyms: C3-C5 METH1
UniProtKB ID: Q9UHI8, D3DSD5, Q9NSJ8, Q9P2K0, Q9UH83, Q9UP80
Gene ID:
Human(9510) Summary: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The protein encoded by this gene contains two disintegrin loops and three C-terminal TS motifs and has anti-angiogenic activity. The expression of this gene may be associated with various inflammatory processes as well as development of cancer cachexia. This gene is likely to be necessary for normal growth, fertility, and organ morphology and function. [provided by RefSeq, Jul 2008]
Mouse(11504) a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 1
Rat(79252) ADAM metallopeptidase with thrombospondin type 1 motif, 1
sheep(100415773) ADAM metallopeptidase with thrombospondin type 1 motif, 1
naked mole-rat(101697805) ADAM metallopeptidase with thrombospondin type 1 motif, 1
domestic guinea pig(100725727) ADAM metallopeptidase with thrombospondin type 1 motif, 1
Zebrafish(565145) ADAM metallopeptidase with thrombospondin type 1 motif, 1
dog(100686153) ADAM metallopeptidase with thrombospondin type 1 motif, 1
cow(512171) ADAM metallopeptidase with thrombospondin type 1 motif, 1
Horse(791251) ADAM metallopeptidase with thrombospondin type 1 motif, 1
domestic cat(101085309) ADAM metallopeptidase with thrombospondin type 1 motif, 1
chicken(418479) ADAM metallopeptidase with thrombospondin type 1 motif, 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009621 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009621 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009621 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006988 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006988 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006988 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006988 Rosetta Predictions human pricing
NM_024400 Rosetta Predictions rat pricing
NM_009621 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006988 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093239 predicted 2064
2 SASI_Hs02_00342727 predicted 3083
3 SASI_Hs01_00093241 predicted 1852
4 SASI_Hs01_00093242 predicted 1187
5 SASI_Hs01_00093243 predicted 3038
6 SASI_Hs01_00093244 predicted 1525
7 SASI_Hs01_00093245 predicted 1494
8 SASI_Hs01_00093246 predicted 2606
9 SASI_Hs01_00093247 predicted 3454
10 SASI_Hs02_00342728 predicted 772
11 SASI_Hs01_00093238 predicted 2786
12 SASI_Hs01_00093240 predicted 1712
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024400 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263999 predicted 2752
2 SASI_Rn01_00044559 predicted 3233
3 SASI_Rn01_00044560 predicted 2315
4 SASI_Rn01_00044562 predicted 2306
5 SASI_Rn01_00044563 predicted 1266
6 SASI_Rn01_00044564 predicted 1120
7 SASI_Rn01_00044565 predicted 3154
8 SASI_Rn02_00264000 predicted 2803
9 SASI_Rn01_00044566 predicted 2289
10 SASI_Rn01_00044567 predicted 2036
11 SASI_Rn01_00044558 predicted 2940
12 SASI_Rn01_00044561 predicted 2602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009621 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030031 predicted 2585
2 SASI_Mm02_00316571 predicted 2696
3 SASI_Mm01_00030032 predicted 2783
4 SASI_Mm01_00030033 predicted 2795
5 SASI_Mm01_00030034 predicted 2616
6 SASI_Mm01_00030035 predicted 2314
7 SASI_Mm02_00316572 predicted 2825
8 SASI_Mm01_00030037 predicted 1140
9 SASI_Mm01_00030038 predicted 2384
10 SASI_Mm01_00030039 predicted 2866
11 SASI_Mm01_00030030 predicted 2820
12 SASI_Mm01_00030036 predicted 2173
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009621
VALIDATED
ADAMTS1 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009621.1-2330s1c1
Sequence:CCGGCCTACAAAGGTACTGTCTTAACTCGAGTTAAGACAGTACCTTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009621.1-210s1c1
Sequence:CCGGCCAGCAGCTACATCTGAAGTTCTCGAGAACTTCAGATGTAGCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009621.1-63s1c1
Sequence:CCGGGCTCCTCGCTTCCATAACAATCTCGAGATTGTTATGGAAGCGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009621.1-1407s1c1
Sequence:CCGGCCGCCAGTGTCAGTTTACATTCTCGAGAATGTAAACTGACACTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009621.1-2386s1c1
Sequence:CCGGCGCAGCTTTAGTCCACTCAAACTCGAGTTTGAGTGGACTAAAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009621.4-3569s21c1
Sequence:CCGGCTTATATCTATCGCCCAAATACTCGAGTATTTGGGCGATAGATATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009621.4-1383s21c1
Sequence:CCGGAGCTCTCACCCTTCGGAATTTCTCGAGAAATTCCGAAGGGTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009621.4-2842s21c1
Sequence:CCGGCGCAGCTTTAGTCCACTCAAACTCGAGTTTGAGTGGACTAAAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009621.4-1863s21c1
Sequence:CCGGCCGCCAGTGTCAGTTTACATTCTCGAGAATGTAAACTGACACTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009621
VALIDATED
ADAMTS1 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009621.1-2330s1c1
Sequence:CCGGCCTACAAAGGTACTGTCTTAACTCGAGTTAAGACAGTACCTTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009621.1-210s1c1
Sequence:CCGGCCAGCAGCTACATCTGAAGTTCTCGAGAACTTCAGATGTAGCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009621.1-63s1c1
Sequence:CCGGGCTCCTCGCTTCCATAACAATCTCGAGATTGTTATGGAAGCGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009621.1-1407s1c1
Sequence:CCGGCCGCCAGTGTCAGTTTACATTCTCGAGAATGTAAACTGACACTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009621.1-2386s1c1
Sequence:CCGGCGCAGCTTTAGTCCACTCAAACTCGAGTTTGAGTGGACTAAAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009621.4-3569s21c1
Sequence:CCGGCTTATATCTATCGCCCAAATACTCGAGTATTTGGGCGATAGATATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009621.4-1383s21c1
Sequence:CCGGAGCTCTCACCCTTCGGAATTTCTCGAGAAATTCCGAAGGGTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009621.4-2842s21c1
Sequence:CCGGCGCAGCTTTAGTCCACTCAAACTCGAGTTTGAGTGGACTAAAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009621.4-1863s21c1
Sequence:CCGGCCGCCAGTGTCAGTTTACATTCTCGAGAATGTAAACTGACACTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009621
VALIDATED
ADAMTS1 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009621.1-2330s1c1
Sequence:CCGGCCTACAAAGGTACTGTCTTAACTCGAGTTAAGACAGTACCTTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009621.1-210s1c1
Sequence:CCGGCCAGCAGCTACATCTGAAGTTCTCGAGAACTTCAGATGTAGCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009621.1-63s1c1
Sequence:CCGGGCTCCTCGCTTCCATAACAATCTCGAGATTGTTATGGAAGCGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009621.1-1407s1c1
Sequence:CCGGCCGCCAGTGTCAGTTTACATTCTCGAGAATGTAAACTGACACTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009621.1-2386s1c1
Sequence:CCGGCGCAGCTTTAGTCCACTCAAACTCGAGTTTGAGTGGACTAAAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009621.4-3569s21c1
Sequence:CCGGCTTATATCTATCGCCCAAATACTCGAGTATTTGGGCGATAGATATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009621.4-1383s21c1
Sequence:CCGGAGCTCTCACCCTTCGGAATTTCTCGAGAAATTCCGAAGGGTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009621.4-2842s21c1
Sequence:CCGGCGCAGCTTTAGTCCACTCAAACTCGAGTTTGAGTGGACTAAAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009621.4-1863s21c1
Sequence:CCGGCCGCCAGTGTCAGTTTACATTCTCGAGAATGTAAACTGACACTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006988
VALIDATED
ADAMTS1 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_006988.2-1584s1c1
Sequence:CCGGGCCTACATGATTACATCATTTCTCGAGAAATGATGTAATCATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_006988.2-1129s1c1
Sequence:CCGGCCAGCATTCGTAATTCAGTTACTCGAGTAACTGAATTACGAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006988.2-2599s1c1
Sequence:CCGGCCACCTTAGAGCAAGACATTACTCGAGTAATGTCTTGCTCTAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_006988.2-967s1c1
Sequence:CCGGCCACAGGAACTGGAAGCATAACTCGAGTTATGCTTCCAGTTCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006988.2-2912s1c1
Sequence:CCGGCGAGTGTGCAAAGGAAGTGAACTCGAGTTCACTTCCTTTGCACACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006988.3-3551s21c1
Sequence:CCGGGGATAGTTAGTGAGGATTATTCTCGAGAATAATCCTCACTAACTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006988.3-3125s21c1
Sequence:CCGGCGAGTGTGCAAAGGAAGTGAACTCGAGTTCACTTCCTTTGCACACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_006988.3-1797s21c1
Sequence:CCGGGCCTACATGATTACATCATTTCTCGAGAAATGATGTAATCATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_006988.3-1180s21c1
Sequence:CCGGCCACAGGAACTGGAAGCATAACTCGAGTTATGCTTCCAGTTCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006988.3-3088s21c1
Sequence:CCGGTGGTAGAATGCCGAGACATTACTCGAGTAATGTCTCGGCATTCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_006988.3-1658s21c1
Sequence:CCGGTGAATTAGGCCACGTGTTTAACTCGAGTTAAACACGTGGCCTAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006988
VALIDATED
ADAMTS1 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_006988.2-1584s1c1
Sequence:CCGGGCCTACATGATTACATCATTTCTCGAGAAATGATGTAATCATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_006988.2-1129s1c1
Sequence:CCGGCCAGCATTCGTAATTCAGTTACTCGAGTAACTGAATTACGAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006988.2-2599s1c1
Sequence:CCGGCCACCTTAGAGCAAGACATTACTCGAGTAATGTCTTGCTCTAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_006988.2-967s1c1
Sequence:CCGGCCACAGGAACTGGAAGCATAACTCGAGTTATGCTTCCAGTTCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006988.2-2912s1c1
Sequence:CCGGCGAGTGTGCAAAGGAAGTGAACTCGAGTTCACTTCCTTTGCACACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006988.3-3551s21c1
Sequence:CCGGGGATAGTTAGTGAGGATTATTCTCGAGAATAATCCTCACTAACTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006988.3-3125s21c1
Sequence:CCGGCGAGTGTGCAAAGGAAGTGAACTCGAGTTCACTTCCTTTGCACACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_006988.3-1797s21c1
Sequence:CCGGGCCTACATGATTACATCATTTCTCGAGAAATGATGTAATCATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_006988.3-1180s21c1
Sequence:CCGGCCACAGGAACTGGAAGCATAACTCGAGTTATGCTTCCAGTTCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006988.3-3088s21c1
Sequence:CCGGTGGTAGAATGCCGAGACATTACTCGAGTAATGTCTCGGCATTCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_006988.3-1658s21c1
Sequence:CCGGTGAATTAGGCCACGTGTTTAACTCGAGTTAAACACGTGGCCTAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006988
VALIDATED
ADAMTS1 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_006988.2-1584s1c1
Sequence:CCGGGCCTACATGATTACATCATTTCTCGAGAAATGATGTAATCATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_006988.2-1129s1c1
Sequence:CCGGCCAGCATTCGTAATTCAGTTACTCGAGTAACTGAATTACGAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006988.2-2599s1c1
Sequence:CCGGCCACCTTAGAGCAAGACATTACTCGAGTAATGTCTTGCTCTAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_006988.2-967s1c1
Sequence:CCGGCCACAGGAACTGGAAGCATAACTCGAGTTATGCTTCCAGTTCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006988.2-2912s1c1
Sequence:CCGGCGAGTGTGCAAAGGAAGTGAACTCGAGTTCACTTCCTTTGCACACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006988.3-3551s21c1
Sequence:CCGGGGATAGTTAGTGAGGATTATTCTCGAGAATAATCCTCACTAACTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006988.3-3125s21c1
Sequence:CCGGCGAGTGTGCAAAGGAAGTGAACTCGAGTTCACTTCCTTTGCACACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_006988.3-1797s21c1
Sequence:CCGGGCCTACATGATTACATCATTTCTCGAGAAATGATGTAATCATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_006988.3-1180s21c1
Sequence:CCGGCCACAGGAACTGGAAGCATAACTCGAGTTATGCTTCCAGTTCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006988.3-3088s21c1
Sequence:CCGGTGGTAGAATGCCGAGACATTACTCGAGTAATGTCTCGGCATTCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_006988.3-1658s21c1
Sequence:CCGGTGAATTAGGCCACGTGTTTAACTCGAGTTAAACACGTGGCCTAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks