EMAIL THIS PAGE TO A FRIEND

ADAMTS20

ADAM metallopeptidase with thrombospondin type 1 motif, 20

76 Gene Product Result for
Synonyms: ADAM-TS20 ADAMTS-20 GON-1
UniProtKB ID: P59510, A6NNC9, J3QT00
Gene ID:
Human(80070) Summary: The protein encoded by this gene is a member of the ADAMTS family of zinc-dependent proteases. The encoded protein has a signal peptide that is cleaved to release the mature peptide, which is secreted and found in the extracellular matrix. This protein may be involved in tissue remodeling. [provided by RefSeq, Sep 2011]
Mouse(223838) a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20
Rat(315263) ADAM metallopeptidase with thrombospondin type 1 motif, 20
domestic guinea pig(100730019) ADAM metallopeptidase with thrombospondin type 1 motif, 20
naked mole-rat(101699077) ADAM metallopeptidase with thrombospondin type 1 motif, 20
sheep(101115444) ADAM metallopeptidase with thrombospondin type 1 motif, 20
chicken(417794) ADAM metallopeptidase with thrombospondin type 1 motif, 20
cow(536137) ADAM metallopeptidase with thrombospondin type 1 motif, 20
domestic cat(101080805) ADAM metallopeptidase with thrombospondin type 1 motif, 20
dog(486602) ADAM metallopeptidase with thrombospondin type 1 motif, 20
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025003 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025003 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025003 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177431 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177431 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177431 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025003 Rosetta Predictions human pricing
NM_175851 Rosetta Predictions human pricing
XM_001058144 Rosetta Predictions rat pricing
XM_235610 Rosetta Predictions rat pricing
NM_177431 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025003 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357655 predicted 647
2 SASI_Hs02_00357656 predicted 5289
3 SASI_Hs02_00357657 predicted 1682
4 SASI_Hs01_00065100 predicted 2904
5 SASI_Hs02_00357658 predicted 2177
6 SASI_Hs02_00357659 predicted 4495
7 SASI_Hs02_00357660 predicted 1890
8 SASI_Hs02_00357661 predicted 1991
9 SASI_Hs01_00065107 predicted 843
10 SASI_Hs01_00065109 predicted 529
11 SASI_Hs01_00065101 predicted 3703
12 SASI_Hs01_00065102 predicted 3262
13 SASI_Hs01_00065103 predicted 2276
14 SASI_Hs01_00065104 predicted 2892
15 SASI_Hs01_00065105 predicted 3843
16 SASI_Hs01_00065106 predicted 3386
17 SASI_Hs01_00065108 predicted 2777
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175851 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178287 predicted 2900
2 SASI_Hs01_00178288 predicted 3702
3 SASI_Hs01_00178289 predicted 3262
4 SASI_Hs01_00178290 predicted 2277
5 SASI_Hs01_00178291 predicted 2897
6 SASI_Hs01_00178292 predicted 3845
7 SASI_Hs01_00178293 predicted 3378
8 SASI_Hs01_00178294 predicted 848
9 SASI_Hs01_00178295 predicted 2787
10 SASI_Hs01_00178296 predicted 532
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058144 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00288725 predicted 2771
2 SASI_Rn02_00288726 predicted 4003
3 SASI_Rn02_00288727 predicted 4533
4 SASI_Rn02_00288728 predicted 4424
5 SASI_Rn02_00288729 predicted 561
6 SASI_Rn02_00288730 predicted 987
7 SASI_Rn02_00288731 predicted 4541
8 SASI_Rn02_00288732 predicted 2444
9 SASI_Rn02_00288733 predicted 792
10 SASI_Rn02_00288734 predicted 1513
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235610 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00197000 predicted 541
2 SASI_Rn01_00197001 predicted 4547
3 SASI_Rn01_00197002 predicted 2403
4 SASI_Rn01_00197003 predicted 1525
5 SASI_Rn01_00197004 predicted 1942
6 SASI_Rn01_00197005 predicted 3167
7 SASI_Rn01_00197006 predicted 3254
8 SASI_Rn01_00197007 predicted 798
9 SASI_Rn01_00197008 predicted 2367
10 SASI_Rn01_00197009 predicted 3177
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177431 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076662 predicted 1016
2 SASI_Mm01_00076663 predicted 4291
3 SASI_Mm01_00076664 predicted 5154
4 SASI_Mm01_00076665 predicted 3456
5 SASI_Mm02_00347635 predicted 2860
6 SASI_Mm01_00076666 predicted 1530
7 SASI_Mm02_00347636 predicted 4771
8 SASI_Mm01_00076667 predicted 700
9 SASI_Mm01_00076669 predicted 5311
10 SASI_Mm02_00347637 predicted 2547
11 SASI_Mm01_00076661 predicted 4996
12 SASI_Mm01_00076668 predicted 735
13 SASI_Mm01_00076670 predicted 2358
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025003
ADAMTS20 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 20
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025003.3-2463s21c1
Sequence:CCGGGGTGTTGTGTGTGGGTAATTTCTCGAGAAATTACCCACACACAACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025003.3-2244s21c1
Sequence:CCGGCATTCGTCAGTACAGCTATTCCTCGAGGAATAGCTGTACTGACGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025003.2-3288s1c1
Sequence:CCGGGCGAGATGTTAAATGTGTCAACTCGAGTTGACACATTTAACATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025003.2-2097s1c1
Sequence:CCGGCGTGTTAAACTCCAGTGCCAACTCGAGTTGGCACTGGAGTTTAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025003.2-4848s1c1
Sequence:CCGGCCCATCTACTAAGAAACATAACTCGAGTTATGTTTCTTAGTAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025003.2-3827s1c1
Sequence:CCGGGCTATTATCTAAGCACGAATTCTCGAGAATTCGTGCTTAGATAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025003.2-656s1c1
Sequence:CCGGGCAACATGAATGAAGATCTTACTCGAGTAAGATCTTCATTCATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025003
ADAMTS20 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 20
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025003.3-2463s21c1
Sequence:CCGGGGTGTTGTGTGTGGGTAATTTCTCGAGAAATTACCCACACACAACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025003.3-2244s21c1
Sequence:CCGGCATTCGTCAGTACAGCTATTCCTCGAGGAATAGCTGTACTGACGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025003.2-3288s1c1
Sequence:CCGGGCGAGATGTTAAATGTGTCAACTCGAGTTGACACATTTAACATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025003.2-2097s1c1
Sequence:CCGGCGTGTTAAACTCCAGTGCCAACTCGAGTTGGCACTGGAGTTTAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025003.2-4848s1c1
Sequence:CCGGCCCATCTACTAAGAAACATAACTCGAGTTATGTTTCTTAGTAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025003.2-3827s1c1
Sequence:CCGGGCTATTATCTAAGCACGAATTCTCGAGAATTCGTGCTTAGATAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025003.2-656s1c1
Sequence:CCGGGCAACATGAATGAAGATCTTACTCGAGTAAGATCTTCATTCATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025003
ADAMTS20 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 20
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025003.3-2463s21c1
Sequence:CCGGGGTGTTGTGTGTGGGTAATTTCTCGAGAAATTACCCACACACAACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025003.3-2244s21c1
Sequence:CCGGCATTCGTCAGTACAGCTATTCCTCGAGGAATAGCTGTACTGACGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025003.2-3288s1c1
Sequence:CCGGGCGAGATGTTAAATGTGTCAACTCGAGTTGACACATTTAACATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025003.2-2097s1c1
Sequence:CCGGCGTGTTAAACTCCAGTGCCAACTCGAGTTGGCACTGGAGTTTAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025003.2-4848s1c1
Sequence:CCGGCCCATCTACTAAGAAACATAACTCGAGTTATGTTTCTTAGTAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025003.2-3827s1c1
Sequence:CCGGGCTATTATCTAAGCACGAATTCTCGAGAATTCGTGCTTAGATAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025003.2-656s1c1
Sequence:CCGGGCAACATGAATGAAGATCTTACTCGAGTAAGATCTTCATTCATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177431
ADAMTS20 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 20
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177431.3-1421s1c1
Sequence:CCGGGCCGGAATTAAACATCAGTATCTCGAGATACTGATGTTTAATTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177431.3-4814s1c1
Sequence:CCGGCGGCTGGTGAAATGTGTGAATCTCGAGATTCACACATTTCACCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177431.3-2038s1c1
Sequence:CCGGCGGTAAACATTTCGACATCAACTCGAGTTGATGTCGAAATGTTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177431.3-3122s1c1
Sequence:CCGGCGGGAATCCTACTGCGTAAATCTCGAGATTTACGCAGTAGGATTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177431.3-3999s1c1
Sequence:CCGGCCAGCAGAAATGTTCCATTAACTCGAGTTAATGGAACATTTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177431
ADAMTS20 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 20
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177431.3-1421s1c1
Sequence:CCGGGCCGGAATTAAACATCAGTATCTCGAGATACTGATGTTTAATTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177431.3-4814s1c1
Sequence:CCGGCGGCTGGTGAAATGTGTGAATCTCGAGATTCACACATTTCACCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177431.3-2038s1c1
Sequence:CCGGCGGTAAACATTTCGACATCAACTCGAGTTGATGTCGAAATGTTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177431.3-3122s1c1
Sequence:CCGGCGGGAATCCTACTGCGTAAATCTCGAGATTTACGCAGTAGGATTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177431.3-3999s1c1
Sequence:CCGGCCAGCAGAAATGTTCCATTAACTCGAGTTAATGGAACATTTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177431
ADAMTS20 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 20
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177431.3-1421s1c1
Sequence:CCGGGCCGGAATTAAACATCAGTATCTCGAGATACTGATGTTTAATTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177431.3-4814s1c1
Sequence:CCGGCGGCTGGTGAAATGTGTGAATCTCGAGATTCACACATTTCACCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177431.3-2038s1c1
Sequence:CCGGCGGTAAACATTTCGACATCAACTCGAGTTGATGTCGAAATGTTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177431.3-3122s1c1
Sequence:CCGGCGGGAATCCTACTGCGTAAATCTCGAGATTTACGCAGTAGGATTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177431.3-3999s1c1
Sequence:CCGGCCAGCAGAAATGTTCCATTAACTCGAGTTAATGGAACATTTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks