EMAIL THIS PAGE TO A FRIEND

ADAMTS2

ADAM metallopeptidase with thrombospondin type 1 motif, 2

80 Gene Product Result for
Synonyms: ADAM-TS2 ADAMTS-2 ADAMTS-3 NPI PC I-NP PCI-NP PCINP PCPNI PNPI
UniProtKB ID: O95450
Gene ID:
Human(9509) Summary: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The enzyme encoded by this gene excises the N-propeptide of type I, type II and type V procollagens. Mutations in this gene cause Ehlers-Danlos syndrome type VIIC, a recessively inherited connective-tissue disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010]
Mouse(216725) a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 2
Rat(287899) ADAM metallopeptidase with thrombospondin type 1 motif, 2
chicken(416291) ADAM metallopeptidase with thrombospondin type 1 motif, 2
cow(282401) ADAM metallopeptidase with thrombospondin type 1 motif, 2
domestic cat(101096945) ADAM metallopeptidase with thrombospondin type 1 motif, 2
dog(481453) ADAM metallopeptidase with thrombospondin type 1 motif, 2
sheep(101120574) ADAM metallopeptidase with thrombospondin type 1 motif, 2
naked mole-rat(101711463) ADAM metallopeptidase with thrombospondin type 1 motif, 2
domestic guinea pig(100721564) ADAM metallopeptidase with thrombospondin type 1 motif, 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175643 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175643 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175643 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014244 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014244 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014244 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014244 Rosetta Predictions human pricing
NM_021599 Rosetta Predictions human pricing
XM_001071965 Rosetta Predictions rat pricing
XM_213548 Rosetta Predictions rat pricing
NM_175643 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014244 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345286 predicted 494
2 SASI_Hs01_00220188 predicted 1078
3 SASI_Hs01_00220190 predicted 1200
4 SASI_Hs02_00345287 predicted 1194
5 SASI_Hs01_00220191 predicted 1200
6 SASI_Hs02_00345288 predicted 1052
7 SASI_Hs02_00345289 predicted 1219
8 SASI_Hs01_00220193 predicted 561
9 SASI_Hs01_00220194 predicted 339
10 SASI_Hs02_00345290 predicted 320
11 SASI_Hs01_00220186 predicted 952
12 SASI_Hs01_00220187 predicted 847
13 SASI_Hs01_00220189 predicted 770
14 SASI_Hs01_00220192 predicted 744
15 SASI_Hs01_00220195 predicted 969
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021599 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354940 predicted 500
2 SASI_Hs01_00171272 predicted 1080
3 SASI_Hs01_00171274 predicted 1201
4 SASI_Hs02_00354941 predicted 1187
5 SASI_Hs01_00171275 predicted 1203
6 SASI_Hs02_00354942 predicted 1051
7 SASI_Hs02_00354943 predicted 1211
8 SASI_Hs01_00171277 predicted 560
9 SASI_Hs01_00171278 predicted 332
10 SASI_Hs02_00354944 predicted 326
11 SASI_Hs01_00171270 predicted 948
12 SASI_Hs01_00171271 predicted 851
13 SASI_Hs01_00171273 predicted 771
14 SASI_Hs01_00171276 predicted 751
15 SASI_Hs01_00171279 predicted 970
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071965 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00337178 predicted 2398
2 SASI_Rn02_00337179 predicted 1201
3 SASI_Rn02_00337180 predicted 3082
4 SASI_Rn02_00337181 predicted 2835
5 SASI_Rn02_00337182 predicted 1913
6 SASI_Rn02_00337183 predicted 1465
7 SASI_Rn02_00337184 predicted 2735
8 SASI_Rn02_00337185 predicted 3852
9 SASI_Rn02_00337186 predicted 1135
10 SASI_Rn02_00337187 predicted 2222
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213548 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374716 predicted 2220
2 SASI_Rn02_00374717 predicted 1026
3 SASI_Rn02_00374718 predicted 2894
4 SASI_Rn02_00374719 predicted 2656
5 SASI_Rn02_00374720 predicted 1734
6 SASI_Rn02_00374721 predicted 1284
7 SASI_Rn02_00374722 predicted 2554
8 SASI_Rn02_00374723 predicted 3662
9 SASI_Rn02_00374724 predicted 951
10 SASI_Rn02_00374725 predicted 1158
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175643 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169844 predicted 1741
2 SASI_Mm01_00169845 predicted 2563
3 SASI_Mm01_00169846 predicted 3510
4 SASI_Mm01_00169847 predicted 1167
5 SASI_Mm01_00169848 predicted 3274
6 SASI_Mm01_00169849 predicted 1281
7 SASI_Mm01_00169850 predicted 1925
8 SASI_Mm01_00169851 predicted 968
9 SASI_Mm01_00169852 predicted 958
10 SASI_Mm02_00346571 predicted 2905
11 SASI_Mm01_00169843 predicted 2390
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175643
ADAMTS2 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000032389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175643.1-3537s1c1
Sequence:CCGGCCACTGAAGATCACCCAGAAACTCGAGTTTCTGGGTGATCTTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175643.1-2362s1c1
Sequence:CCGGCCACCATCTGTCTGTCAAGAACTCGAGTTCTTGACAGACAGATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175643.1-1976s1c1
Sequence:CCGGCTGTACTTTGAGCACGGTGATCTCGAGATCACCGTGCTCAAAGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175643.1-3271s1c1
Sequence:CCGGCCAAGGCGACAAGTCAATGTTCTCGAGAACATTGACTTGTCGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175643
ADAMTS2 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000032389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175643.1-3537s1c1
Sequence:CCGGCCACTGAAGATCACCCAGAAACTCGAGTTTCTGGGTGATCTTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175643.1-2362s1c1
Sequence:CCGGCCACCATCTGTCTGTCAAGAACTCGAGTTCTTGACAGACAGATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175643.1-1976s1c1
Sequence:CCGGCTGTACTTTGAGCACGGTGATCTCGAGATCACCGTGCTCAAAGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175643.1-3271s1c1
Sequence:CCGGCCAAGGCGACAAGTCAATGTTCTCGAGAACATTGACTTGTCGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175643
ADAMTS2 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000032389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175643.1-3537s1c1
Sequence:CCGGCCACTGAAGATCACCCAGAAACTCGAGTTTCTGGGTGATCTTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175643.1-2362s1c1
Sequence:CCGGCCACCATCTGTCTGTCAAGAACTCGAGTTCTTGACAGACAGATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175643.1-1976s1c1
Sequence:CCGGCTGTACTTTGAGCACGGTGATCTCGAGATCACCGTGCTCAAAGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175643.1-3271s1c1
Sequence:CCGGCCAAGGCGACAAGTCAATGTTCTCGAGAACATTGACTTGTCGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014244
ADAMTS2 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014244.1-3478s1c1
Sequence:CCGGGCCGTAGATGAACCCTACAAACTCGAGTTTGTAGGGTTCATCTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014244.1-2205s1c1
Sequence:CCGGGCATGGTTACATCAAGATGTTCTCGAGAACATCTTGATGTAACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014244.1-556s1c1
Sequence:CCGGGAGGAGGAGTTCTTCATCGAACTCGAGTTCGATGAAGAACTCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014244.1-3282s1c1
Sequence:CCGGCCTGTACAACAACCTCACCAACTCGAGTTGGTGAGGTTGTTGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014244.1-3466s1c1
Sequence:CCGGCCAGAAACCAATGCCGTAGATCTCGAGATCTACGGCATTGGTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014244.2-2480s21c1
Sequence:CCGGGGGTCTCACTGACGTACAAATCTCGAGATTTGTACGTCAGTGAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014244.2-3189s21c1
Sequence:CCGGCCAAGGCGACAAGTCAATATTCTCGAGAATATTGACTTGTCGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014244
ADAMTS2 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014244.1-3478s1c1
Sequence:CCGGGCCGTAGATGAACCCTACAAACTCGAGTTTGTAGGGTTCATCTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014244.1-2205s1c1
Sequence:CCGGGCATGGTTACATCAAGATGTTCTCGAGAACATCTTGATGTAACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014244.1-556s1c1
Sequence:CCGGGAGGAGGAGTTCTTCATCGAACTCGAGTTCGATGAAGAACTCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014244.1-3282s1c1
Sequence:CCGGCCTGTACAACAACCTCACCAACTCGAGTTGGTGAGGTTGTTGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014244.1-3466s1c1
Sequence:CCGGCCAGAAACCAATGCCGTAGATCTCGAGATCTACGGCATTGGTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014244.2-2480s21c1
Sequence:CCGGGGGTCTCACTGACGTACAAATCTCGAGATTTGTACGTCAGTGAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014244.2-3189s21c1
Sequence:CCGGCCAAGGCGACAAGTCAATATTCTCGAGAATATTGACTTGTCGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014244
ADAMTS2 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014244.1-3478s1c1
Sequence:CCGGGCCGTAGATGAACCCTACAAACTCGAGTTTGTAGGGTTCATCTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014244.1-2205s1c1
Sequence:CCGGGCATGGTTACATCAAGATGTTCTCGAGAACATCTTGATGTAACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014244.1-556s1c1
Sequence:CCGGGAGGAGGAGTTCTTCATCGAACTCGAGTTCGATGAAGAACTCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014244.1-3282s1c1
Sequence:CCGGCCTGTACAACAACCTCACCAACTCGAGTTGGTGAGGTTGTTGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014244.1-3466s1c1
Sequence:CCGGCCAGAAACCAATGCCGTAGATCTCGAGATCTACGGCATTGGTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014244.2-2480s21c1
Sequence:CCGGGGGTCTCACTGACGTACAAATCTCGAGATTTGTACGTCAGTGAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014244.2-3189s21c1
Sequence:CCGGCCAAGGCGACAAGTCAATATTCTCGAGAATATTGACTTGTCGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks