EMAIL THIS PAGE TO A FRIEND

ADAMTS3

ADAM metallopeptidase with thrombospondin type 1 motif, 3

153 Gene Product Result for
Synonyms: ADAMTS-4
UniProtKB ID: O15072, A1L3U9, Q9BXZ8
Gene ID:
Human(9508) Summary: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The protein encoded by this gene is the major procollagen II N-propeptidase. A deficiency of this protein may be responsible for dermatosparaxis, a genetic defect of connective tissues. [provided by RefSeq, Jul 2008]
Mouse(330119) a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 3
Rat(305253) ADAM metallopeptidase with thrombospondin type 1, motif 3
chicken(428760) ADAM metallopeptidase with thrombospondin type 1 motif, 3
cow(534082) ADAM metallopeptidase with thrombospondin type 1 motif, 3
Horse(100050106) ADAM metallopeptidase with thrombospondin type 1 motif, 3
domestic cat(101095822) ADAM metallopeptidase with thrombospondin type 1 motif, 3
dog(482192) ADAM metallopeptidase with thrombospondin type 1 motif, 3
sheep(101102903) ADAM metallopeptidase with thrombospondin type 1 motif, 3
Domestic Rabbit(100345799) ADAM metallopeptidase with thrombospondin type 1 motif, 3
naked mole-rat(101701511) ADAM metallopeptidase with thrombospondin type 1 motif, 3
domestic guinea pig(100728969) ADAM metallopeptidase with thrombospondin type 1 motif, 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014243 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014243 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014243 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177872 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177872 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177872 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014243 Rosetta Predictions human pricing
NM_001107212 Rosetta Predictions rat pricing
NM_001081401 Rosetta Predictions mouse pricing
XM_887407 Rosetta Predictions mouse pricing
XM_978433 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014243 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086900 predicted 316
2 SASI_Hs01_00086901 predicted 3627
3 SASI_Hs01_00086902 predicted 3502
4 SASI_Hs02_00345283 predicted 3349
5 SASI_Hs01_00086904 predicted 1437
6 SASI_Hs01_00086905 predicted 2098
7 SASI_Hs01_00086906 predicted 1967
8 SASI_Hs02_00345284 predicted 3086
9 SASI_Hs02_00345285 predicted 1150
10 SASI_Hs01_00086909 predicted 1776
11 SASI_Hs01_00086903 predicted 3620
12 SASI_Hs01_00086907 predicted 2252
13 SASI_Hs01_00086908 predicted 1797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107212 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226615 predicted 2299
2 SASI_Rn02_00226616 predicted 963
3 SASI_Rn02_00226617 predicted 2926
4 SASI_Rn02_00226618 predicted 1979
5 SASI_Rn02_00226619 predicted 601
6 SASI_Rn02_00226620 predicted 1884
7 SASI_Rn02_00226621 predicted 1128
8 SASI_Rn02_00226622 predicted 675
9 SASI_Rn02_00226623 predicted 2860
10 SASI_Rn02_00226624 predicted 587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081401 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298031 predicted 2372
2 SASI_Mm02_00298032 predicted 3094
3 SASI_Mm02_00298033 predicted 2520
4 SASI_Mm02_00298034 predicted 3244
5 SASI_Mm02_00298035 predicted 2728
6 SASI_Mm02_00298036 predicted 2005
7 SASI_Mm02_00298037 predicted 1646
8 SASI_Mm02_00298038 predicted 2561
9 SASI_Mm02_00298039 predicted 591
10 SASI_Mm02_00298040 predicted 3954
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_887407 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00255616 predicted 652
2 SASI_Mm01_00255617 predicted 693
3 SASI_Mm01_00255618 predicted 679
4 SASI_Mm01_00255619 predicted 1001
5 SASI_Mm01_00255620 predicted 659
6 SASI_Mm01_00255621 predicted 1145
7 SASI_Mm01_00255622 predicted 673
8 SASI_Mm01_00255623 predicted 795
9 SASI_Mm01_00255624 predicted 1135
10 SASI_Mm01_00255625 predicted 892
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_978433 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00222077 predicted 3103
2 SASI_Mm01_00222078 predicted 2523
3 SASI_Mm01_00222079 predicted 3247
4 SASI_Mm01_00222080 predicted 4015
5 SASI_Mm01_00222081 predicted 2734
6 SASI_Mm01_00222082 predicted 2009
7 SASI_Mm01_00222083 predicted 1654
8 SASI_Mm01_00222084 predicted 2567
9 SASI_Mm01_00222085 predicted 598
10 SASI_Mm01_00222086 predicted 3960
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014243
ADAMTS3 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014243.1-5443s1c1
Sequence:CCGGCGTTGTAAACTAACAGCTTAACTCGAGTTAAGCTGTTAGTTTACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014243.1-2494s1c1
Sequence:CCGGCCTGACATATAAGTACATCATCTCGAGATGATGTACTTATATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014243.1-3552s1c1
Sequence:CCGGCCAGTGATTCAATAGGTGCTTCTCGAGAAGCACCTATTGAATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014243.1-955s1c1
Sequence:CCGGGCGCATGATAATGCTGGGATACTCGAGTATCCCAGCATTATCATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014243.1-1902s1c1
Sequence:CCGGCCCACTTTGAATACCAGAATACTCGAGTATTCTGGTATTCAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014243
ADAMTS3 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014243.1-5443s1c1
Sequence:CCGGCGTTGTAAACTAACAGCTTAACTCGAGTTAAGCTGTTAGTTTACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014243.1-2494s1c1
Sequence:CCGGCCTGACATATAAGTACATCATCTCGAGATGATGTACTTATATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014243.1-3552s1c1
Sequence:CCGGCCAGTGATTCAATAGGTGCTTCTCGAGAAGCACCTATTGAATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014243.1-955s1c1
Sequence:CCGGGCGCATGATAATGCTGGGATACTCGAGTATCCCAGCATTATCATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014243.1-1902s1c1
Sequence:CCGGCCCACTTTGAATACCAGAATACTCGAGTATTCTGGTATTCAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014243
ADAMTS3 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014243.1-5443s1c1
Sequence:CCGGCGTTGTAAACTAACAGCTTAACTCGAGTTAAGCTGTTAGTTTACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014243.1-2494s1c1
Sequence:CCGGCCTGACATATAAGTACATCATCTCGAGATGATGTACTTATATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014243.1-3552s1c1
Sequence:CCGGCCAGTGATTCAATAGGTGCTTCTCGAGAAGCACCTATTGAATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014243.1-955s1c1
Sequence:CCGGGCGCATGATAATGCTGGGATACTCGAGTATCCCAGCATTATCATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014243.1-1902s1c1
Sequence:CCGGCCCACTTTGAATACCAGAATACTCGAGTATTCTGGTATTCAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177872
ADAMTS3 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177872.1-1562s1c1
Sequence:CCGGCCTGCTTCTAACTGGAATGTACTCGAGTACATTCCAGTTAGAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177872.1-933s1c1
Sequence:CCGGGCAACTGTGATGGTCTGACTTCTCGAGAAGTCAGACCATCACAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177872.1-1108s1c1
Sequence:CCGGTCAGCATCAGATGGTTGGGTTCTCGAGAACCCAACCATCTGATGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177872.1-696s1c1
Sequence:CCGGTCACGGCATTTGGAAGAGATTCTCGAGAATCTCTTCCAAATGCCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177872.1-662s1c1
Sequence:CCGGGTGTCATCTAACTCAGAGCATCTCGAGATGCTCTGAGTTAGATGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177872
ADAMTS3 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177872.1-1562s1c1
Sequence:CCGGCCTGCTTCTAACTGGAATGTACTCGAGTACATTCCAGTTAGAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177872.1-933s1c1
Sequence:CCGGGCAACTGTGATGGTCTGACTTCTCGAGAAGTCAGACCATCACAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177872.1-1108s1c1
Sequence:CCGGTCAGCATCAGATGGTTGGGTTCTCGAGAACCCAACCATCTGATGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177872.1-696s1c1
Sequence:CCGGTCACGGCATTTGGAAGAGATTCTCGAGAATCTCTTCCAAATGCCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177872.1-662s1c1
Sequence:CCGGGTGTCATCTAACTCAGAGCATCTCGAGATGCTCTGAGTTAGATGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177872
ADAMTS3 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177872.1-1562s1c1
Sequence:CCGGCCTGCTTCTAACTGGAATGTACTCGAGTACATTCCAGTTAGAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177872.1-933s1c1
Sequence:CCGGGCAACTGTGATGGTCTGACTTCTCGAGAAGTCAGACCATCACAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177872.1-1108s1c1
Sequence:CCGGTCAGCATCAGATGGTTGGGTTCTCGAGAACCCAACCATCTGATGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177872.1-696s1c1
Sequence:CCGGTCACGGCATTTGGAAGAGATTCTCGAGAATCTCTTCCAAATGCCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177872.1-662s1c1
Sequence:CCGGGTGTCATCTAACTCAGAGCATCTCGAGATGCTCTGAGTTAGATGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks