EMAIL THIS PAGE TO A FRIEND

ADAMTS4

ADAM metallopeptidase with thrombospondin type 1 motif, 4

Synonyms: ADAMTS-2 ADAMTS-4 ADMP-1
UniProtKB ID: O75173, Q5VTW2, Q6P4Q8, Q6UWA8, Q9UN83
Gene ID:
Human(9507) Summary: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The enzyme encoded by this gene lacks a C-terminal TS motif. It is responsible for the degradation of aggrecan, a major proteoglycan of cartilage, and brevican, a brain-specific extracellular matrix protein. The cleavage of aggrecan and brevican suggests key roles of this enzyme in arthritic disease and in the central nervous system, potentially, in the progression of glioma. [provided by RefSeq, Jul 2008]
Mouse(240913) a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 4
Rat(66015) ADAM metallopeptidase with thrombospondin type 1 motif, 4
domestic guinea pig(100712995) ADAM metallopeptidase with thrombospondin type 1 motif, 4
naked mole-rat(101702362) ADAM metallopeptidase with thrombospondin type 1 motif, 4
sheep(101106565) ADAM metallopeptidase with thrombospondin type 1 motif, 4
dog(488651) ADAM metallopeptidase with thrombospondin type 1 motif, 4
domestic cat(101089488) ADAM metallopeptidase with thrombospondin type 1 motif, 4
cow(286806) ADAM metallopeptidase with thrombospondin type 1 motif, 4
Horse(100033914) ADAM metallopeptidase with thrombospondin type 1 motif, 4
117 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172845 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172845 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172845 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005099 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005099 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005099 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU023391 MISSION® esiRNA esiRNA targeting mouse Adamts4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005099 Rosetta Predictions human pricing
XM_001053685 Rosetta Predictions rat pricing
XM_341154 Rosetta Predictions rat pricing
NM_172845 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005099 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042882 predicted 1071
2 SASI_Hs01_00042883 predicted 954
3 SASI_Hs01_00042884 predicted 2593
4 SASI_Hs01_00042885 predicted 2982
5 SASI_Hs01_00042886 predicted 2413
6 SASI_Hs01_00042887 predicted 2765
7 SASI_Hs01_00042888 predicted 1180
8 SASI_Hs02_00338980 predicted 606
9 SASI_Hs01_00042889 predicted 2628
10 SASI_Hs01_00042890 predicted 1488
11 SASI_Hs01_00042891 predicted 2507
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053685 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00273200 predicted 2176
2 SASI_Rn02_00273201 predicted 967
3 SASI_Rn02_00273202 predicted 1134
4 SASI_Rn02_00273203 predicted 1184
5 SASI_Rn02_00273204 predicted 1408
6 SASI_Rn02_00273205 predicted 1789
7 SASI_Rn02_00273206 predicted 1162
8 SASI_Rn02_00273207 predicted 321
9 SASI_Rn02_00273208 predicted 448
10 SASI_Rn02_00273209 predicted 838
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341154 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392493 predicted 1748
2 SASI_Rn02_00392494 predicted 1788
3 SASI_Rn02_00392495 predicted 1809
4 SASI_Rn02_00392496 predicted 1829
5 SASI_Rn02_00392497 predicted 1683
6 SASI_Rn02_00392498 predicted 1881
7 SASI_Rn02_00392499 predicted 1651
8 SASI_Rn02_00392500 predicted 1681
9 SASI_Rn02_00392501 predicted 1755
10 SASI_Rn02_00392502 predicted 1700
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172845 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044319 predicted 2539
2 SASI_Mm01_00044320 predicted 2878
3 SASI_Mm01_00044322 predicted 1323
4 SASI_Mm01_00044323 predicted 2979
5 SASI_Mm01_00044324 predicted 1518
6 SASI_Mm02_00344790 predicted 2145
7 SASI_Mm01_00044325 predicted 1104
8 SASI_Mm01_00044326 predicted 1478
9 SASI_Mm01_00044327 predicted 2576
10 SASI_Mm02_00344791 predicted 2033
11 SASI_Mm01_00044321 predicted 953
12 SASI_Mm01_00044328 predicted 681
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172845
VALIDATED
ADAMTS4 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172845.1-1707s1c1
Sequence:CCGGCCCTCCATCTACCAGCGACTTCTCGAGAAGTCGCTGGTAGATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172845.1-2879s1c1
Sequence:CCGGGCAGAGATACTGAAGATCCTTCTCGAGAAGGATCTTCAGTATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172845.1-1337s1c1
Sequence:CCGGGACCACTTTGACACAGCCATTCTCGAGAATGGCTGTGTCAAAGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172845.1-2798s1c1
Sequence:CCGGCGTCTGCGGTACAGTTTCTTTCTCGAGAAAGAAACTGTACCGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172845.2-3332s21c1
Sequence:CCGGCAGGGTGTTGGTGACAAATATCTCGAGATATTTGTCACCAACACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172845.2-1157s21c1
Sequence:CCGGGCTGCCGCTAAAGCCTTTAAACTCGAGTTTAAAGGCTTTAGCGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172845.2-2798s21c1
Sequence:CCGGCGTCTGCGGTACAGTTTCTTTCTCGAGAAAGAAACTGTACCGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172845.2-2620s21c1
Sequence:CCGGTTACGCCCTCAATGGTGAATACTCGAGTATTCACCATTGAGGGCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172845.2-1052s21c1
Sequence:CCGGTTCGCTTCTCTGAGTAGATTCCTCGAGGAATCTACTCAGAGAAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172845
VALIDATED
ADAMTS4 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172845.1-1707s1c1
Sequence:CCGGCCCTCCATCTACCAGCGACTTCTCGAGAAGTCGCTGGTAGATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172845.1-2879s1c1
Sequence:CCGGGCAGAGATACTGAAGATCCTTCTCGAGAAGGATCTTCAGTATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172845.1-1337s1c1
Sequence:CCGGGACCACTTTGACACAGCCATTCTCGAGAATGGCTGTGTCAAAGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172845.1-2798s1c1
Sequence:CCGGCGTCTGCGGTACAGTTTCTTTCTCGAGAAAGAAACTGTACCGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172845.2-3332s21c1
Sequence:CCGGCAGGGTGTTGGTGACAAATATCTCGAGATATTTGTCACCAACACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172845.2-1157s21c1
Sequence:CCGGGCTGCCGCTAAAGCCTTTAAACTCGAGTTTAAAGGCTTTAGCGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172845.2-2798s21c1
Sequence:CCGGCGTCTGCGGTACAGTTTCTTTCTCGAGAAAGAAACTGTACCGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172845.2-2620s21c1
Sequence:CCGGTTACGCCCTCAATGGTGAATACTCGAGTATTCACCATTGAGGGCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172845.2-1052s21c1
Sequence:CCGGTTCGCTTCTCTGAGTAGATTCCTCGAGGAATCTACTCAGAGAAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172845
VALIDATED
ADAMTS4 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172845.1-1707s1c1
Sequence:CCGGCCCTCCATCTACCAGCGACTTCTCGAGAAGTCGCTGGTAGATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172845.1-2879s1c1
Sequence:CCGGGCAGAGATACTGAAGATCCTTCTCGAGAAGGATCTTCAGTATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172845.1-1337s1c1
Sequence:CCGGGACCACTTTGACACAGCCATTCTCGAGAATGGCTGTGTCAAAGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172845.1-2798s1c1
Sequence:CCGGCGTCTGCGGTACAGTTTCTTTCTCGAGAAAGAAACTGTACCGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172845.2-3332s21c1
Sequence:CCGGCAGGGTGTTGGTGACAAATATCTCGAGATATTTGTCACCAACACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172845.2-1157s21c1
Sequence:CCGGGCTGCCGCTAAAGCCTTTAAACTCGAGTTTAAAGGCTTTAGCGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172845.2-2798s21c1
Sequence:CCGGCGTCTGCGGTACAGTTTCTTTCTCGAGAAAGAAACTGTACCGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172845.2-2620s21c1
Sequence:CCGGTTACGCCCTCAATGGTGAATACTCGAGTATTCACCATTGAGGGCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172845.2-1052s21c1
Sequence:CCGGTTCGCTTCTCTGAGTAGATTCCTCGAGGAATCTACTCAGAGAAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005099
ADAMTS4 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005099.3-610s1c1
Sequence:CCGGCGTGTTTCCAGAGAAGCTCAACTCGAGTTGAGCTTCTCTGGAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005099.3-2503s1c1
Sequence:CCGGCAGGAAATTCAGGTACGGATACTCGAGTATCCGTACCTGAATTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005099.3-2765s1c1
Sequence:CCGGCCTTTGACACTGCAAGTCCTACTCGAGTAGGACTTGCAGTGTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005099.3-1105s1c1
Sequence:CCGGAGATGACAAGATGGCCGCATTCTCGAGAATGCGGCCATCTTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005099.3-1558s1c1
Sequence:CCGGCATCAGTTTGAATGGGCCTTTCTCGAGAAAGGCCCATTCAAACTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005099.4-874s21c1
Sequence:CCGGTGTTAGGCGTGTTACAATATCCTCGAGGATATTGTAACACGCCTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005099.4-2305s21c1
Sequence:CCGGAGGCACTGGGCTACTACTATGCTCGAGCATAGTAGTAGCCCAGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005099
ADAMTS4 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005099.3-610s1c1
Sequence:CCGGCGTGTTTCCAGAGAAGCTCAACTCGAGTTGAGCTTCTCTGGAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005099.3-2503s1c1
Sequence:CCGGCAGGAAATTCAGGTACGGATACTCGAGTATCCGTACCTGAATTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005099.3-2765s1c1
Sequence:CCGGCCTTTGACACTGCAAGTCCTACTCGAGTAGGACTTGCAGTGTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005099.3-1105s1c1
Sequence:CCGGAGATGACAAGATGGCCGCATTCTCGAGAATGCGGCCATCTTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005099.3-1558s1c1
Sequence:CCGGCATCAGTTTGAATGGGCCTTTCTCGAGAAAGGCCCATTCAAACTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005099.4-874s21c1
Sequence:CCGGTGTTAGGCGTGTTACAATATCCTCGAGGATATTGTAACACGCCTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005099.4-2305s21c1
Sequence:CCGGAGGCACTGGGCTACTACTATGCTCGAGCATAGTAGTAGCCCAGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005099
ADAMTS4 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005099.3-610s1c1
Sequence:CCGGCGTGTTTCCAGAGAAGCTCAACTCGAGTTGAGCTTCTCTGGAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005099.3-2503s1c1
Sequence:CCGGCAGGAAATTCAGGTACGGATACTCGAGTATCCGTACCTGAATTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005099.3-2765s1c1
Sequence:CCGGCCTTTGACACTGCAAGTCCTACTCGAGTAGGACTTGCAGTGTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005099.3-1105s1c1
Sequence:CCGGAGATGACAAGATGGCCGCATTCTCGAGAATGCGGCCATCTTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005099.3-1558s1c1
Sequence:CCGGCATCAGTTTGAATGGGCCTTTCTCGAGAAAGGCCCATTCAAACTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005099.4-874s21c1
Sequence:CCGGTGTTAGGCGTGTTACAATATCCTCGAGGATATTGTAACACGCCTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005099.4-2305s21c1
Sequence:CCGGAGGCACTGGGCTACTACTATGCTCGAGCATAGTAGTAGCCCAGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks