EMAIL THIS PAGE TO A FRIEND

ADAMTS5

ADAM metallopeptidase with thrombospondin type 1 motif, 5

232 Gene Product Result for
Synonyms: ADAM-TS 11 ADAM-TS 5 ADAM-TS5 ADAMTS-11 ADAMTS-5 ADAMTS11 ADMP-2
UniProtKB ID: Q9UNA0, Q52LV4, Q9UKP2
Gene ID:
Human(11096) Summary: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The enzyme encoded by this gene contains two C-terminal TS motifs and functions as aggrecanase to cleave aggrecan, a major proteoglycan of cartilage. [provided by RefSeq, Jul 2008]
Mouse(23794) a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)
Rat(304135) ADAM metallopeptidase with thrombospondin type 1 motif, 5
Zebrafish(565053) ADAM metallopeptidase with thrombospondin type 1 motif, 5
chicken(427971) ADAM metallopeptidase with thrombospondin type 1 motif, 5
cow(286805) ADAM metallopeptidase with thrombospondin type 1 motif, 5
Horse(100033915) ADAM metallopeptidase with thrombospondin type 1 motif, 5
Horse(100066005) ADAM metallopeptidase with thrombospondin type 1 motif, 5
domestic cat(101085063) ADAM metallopeptidase with thrombospondin type 1 motif, 5
dog(487713) ADAM metallopeptidase with thrombospondin type 1 motif, 5
sheep(101110635) ADAM metallopeptidase with thrombospondin type 1 motif, 5
Domestic Rabbit(100008799) ADAM metallopeptidase with thrombospondin type 1 motif, 5
naked mole-rat(101698184) ADAM metallopeptidase with thrombospondin type 1 motif, 5
domestic guinea pig(100715022) ADAM metallopeptidase with thrombospondin type 1 motif, 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007038 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007038 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007038 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011782 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011782 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011782 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007038 Rosetta Predictions human pricing
NM_198761 Rosetta Predictions rat pricing
NM_011782 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007038 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235086 predicted 1219
2 SASI_Hs01_00235087 predicted 2637
3 SASI_Hs01_00235088 predicted 2914
4 SASI_Hs01_00235089 predicted 1454
5 SASI_Hs01_00235090 predicted 1414
6 SASI_Hs01_00235091 predicted 2309
7 SASI_Hs01_00235092 predicted 2531
8 SASI_Hs01_00235093 predicted 1947
9 SASI_Hs01_00235094 predicted 2705
10 SASI_Hs01_00235095 predicted 2581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198761 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063570 predicted 1091
2 SASI_Rn01_00063571 predicted 1567
3 SASI_Rn01_00063573 predicted 2179
4 SASI_Rn01_00063574 predicted 1678
5 SASI_Rn01_00063575 predicted 876
6 SASI_Rn01_00063576 predicted 235
7 SASI_Rn01_00063577 predicted 1293
8 SASI_Rn01_00063578 predicted 2517
9 SASI_Rn02_00270001 predicted 2374
10 SASI_Rn01_00063579 predicted 2398
11 SASI_Rn01_00063572 predicted 2343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011782 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075823 predicted 2242
2 SASI_Mm02_00321430 predicted 3695
3 SASI_Mm01_00075824 predicted 2982
4 SASI_Mm01_00075825 predicted 2611
5 SASI_Mm01_00075826 predicted 1954
6 SASI_Mm01_00075828 predicted 2431
7 SASI_Mm01_00075830 predicted 2157
8 SASI_Mm01_00075831 predicted 3201
9 SASI_Mm01_00075832 predicted 1383
10 SASI_Mm02_00321431 predicted 2916
11 SASI_Mm01_00075827 predicted 2725
12 SASI_Mm01_00075829 predicted 262
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007038
ADAMTS5 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 5
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007038.3-3252s21c1
Sequence:CCGGACCATTAGATGTCCGTTATAGCTCGAGCTATAACGGACATCTAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007038.3-1805s21c1
Sequence:CCGGACGATGCAGCTATCCTGTTTACTCGAGTAAACAGGATAGCTGCATCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007038.1-1347s1c1
Sequence:CCGGGCTCACGAAATCGGACATTTACTCGAGTAAATGTCCGATTTCGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007038.1-2423s1c1
Sequence:CCGGCCAGACTAGATTCACTGCCTACTCGAGTAGGCAGTGAATCTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007038.1-1417s1c1
Sequence:CCGGCCACAGAAGATAAGCGCTTAACTCGAGTTAAGCGCTTATCTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007038.1-344s1c1
Sequence:CCGGGCAGAACATCGACCAACTCTACTCGAGTAGAGTTGGTCGATGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007038
ADAMTS5 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 5
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007038.3-3252s21c1
Sequence:CCGGACCATTAGATGTCCGTTATAGCTCGAGCTATAACGGACATCTAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007038.3-1805s21c1
Sequence:CCGGACGATGCAGCTATCCTGTTTACTCGAGTAAACAGGATAGCTGCATCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007038.1-1347s1c1
Sequence:CCGGGCTCACGAAATCGGACATTTACTCGAGTAAATGTCCGATTTCGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007038.1-2423s1c1
Sequence:CCGGCCAGACTAGATTCACTGCCTACTCGAGTAGGCAGTGAATCTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007038.1-1417s1c1
Sequence:CCGGCCACAGAAGATAAGCGCTTAACTCGAGTTAAGCGCTTATCTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007038.1-344s1c1
Sequence:CCGGGCAGAACATCGACCAACTCTACTCGAGTAGAGTTGGTCGATGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007038
ADAMTS5 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 5
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007038.3-3252s21c1
Sequence:CCGGACCATTAGATGTCCGTTATAGCTCGAGCTATAACGGACATCTAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007038.3-1805s21c1
Sequence:CCGGACGATGCAGCTATCCTGTTTACTCGAGTAAACAGGATAGCTGCATCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007038.1-1347s1c1
Sequence:CCGGGCTCACGAAATCGGACATTTACTCGAGTAAATGTCCGATTTCGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007038.1-2423s1c1
Sequence:CCGGCCAGACTAGATTCACTGCCTACTCGAGTAGGCAGTGAATCTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007038.1-1417s1c1
Sequence:CCGGCCACAGAAGATAAGCGCTTAACTCGAGTTAAGCGCTTATCTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007038.1-344s1c1
Sequence:CCGGGCAGAACATCGACCAACTCTACTCGAGTAGAGTTGGTCGATGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011782
ADAMTS5 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 5
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000032064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011782.1-543s1c1
Sequence:CCGGGCAGAGTATGAACGAATTTATCTCGAGATAAATTCGTTCATACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011782.1-1116s1c1
Sequence:CCGGCGAGAGGATTTATGTGGGCATCTCGAGATGCCCACATAAATCCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011782.1-2363s1c1
Sequence:CCGGCGAGTACCTTATCAATGGCAACTCGAGTTGCCATTGATAAGGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011782.1-242s1c1
Sequence:CCGGCCATAATATAGACCAACTCTACTCGAGTAGAGTTGGTCTATATTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011782
ADAMTS5 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 5
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000032064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011782.1-543s1c1
Sequence:CCGGGCAGAGTATGAACGAATTTATCTCGAGATAAATTCGTTCATACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011782.1-1116s1c1
Sequence:CCGGCGAGAGGATTTATGTGGGCATCTCGAGATGCCCACATAAATCCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011782.1-2363s1c1
Sequence:CCGGCGAGTACCTTATCAATGGCAACTCGAGTTGCCATTGATAAGGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011782.1-242s1c1
Sequence:CCGGCCATAATATAGACCAACTCTACTCGAGTAGAGTTGGTCTATATTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011782
ADAMTS5 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 5
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000032064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011782.1-543s1c1
Sequence:CCGGGCAGAGTATGAACGAATTTATCTCGAGATAAATTCGTTCATACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011782.1-1116s1c1
Sequence:CCGGCGAGAGGATTTATGTGGGCATCTCGAGATGCCCACATAAATCCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011782.1-2363s1c1
Sequence:CCGGCGAGTACCTTATCAATGGCAACTCGAGTTGCCATTGATAAGGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011782.1-242s1c1
Sequence:CCGGCCATAATATAGACCAACTCTACTCGAGTAGAGTTGGTCTATATTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks