EMAIL THIS PAGE TO A FRIEND

ADAMTS6

ADAM metallopeptidase with thrombospondin type 1 motif, 6

228 Gene Product Result for
Synonyms: ADAM-TS 6 ADAM-TS6 ADAMTS-6
UniProtKB ID: Q9UKP5, Q59EX6, Q5IR87, Q5IR88, Q5IR89, Q68DL1
Gene ID:
Human(11174) Summary: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. [provided by RefSeq, Jul 2008]
Mouse(108154) a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 6
Rat(361886) ADAM metallopeptidase with thrombospondin type 1 motif, 6
domestic guinea pig(100730230) ADAM metallopeptidase with thrombospondin type 1 motif, 6
naked mole-rat(101715883) ADAM metallopeptidase with thrombospondin type 1 motif, 6
sheep(101103840) ADAM metallopeptidase with thrombospondin type 1 motif, 6
Domestic Rabbit(100355552) ADAM metallopeptidase with thrombospondin type 1 motif, 6
Zebrafish(569099) ADAM metallopeptidase with thrombospondin type 1 motif, 6
chicken(427160) ADAM metallopeptidase with thrombospondin type 1 motif, 6
dog(478077) ADAM metallopeptidase with thrombospondin type 1 motif, 6
domestic cat(101080862) ADAM metallopeptidase with thrombospondin type 1 motif, 6
cow(540722) ADAM metallopeptidase with thrombospondin type 1 motif, 6
Horse(100050673) ADAM metallopeptidase with thrombospondin type 1 motif, 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_197941 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_197941 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_197941 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_014273 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014273 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014273 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081020 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081020 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081020 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_197941 Rosetta Predictions human pricing
NM_001108544 Rosetta Predictions rat pricing
NM_001081020 Rosetta Predictions mouse pricing
XM_001002065 Rosetta Predictions mouse pricing
XM_897390 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197941 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371547 predicted 3429
2 SASI_Hs01_00225294 predicted 3129
3 SASI_Hs01_00225297 predicted 3050
4 SASI_Hs02_00371548 predicted 910
5 SASI_Hs01_00225298 predicted 1098
6 SASI_Hs01_00225299 predicted 2018
7 SASI_Hs01_00225300 predicted 1857
8 SASI_Hs01_00225301 predicted 2099
9 SASI_Hs02_00371549 predicted 2276
10 SASI_Hs01_00225302 predicted 937
11 SASI_Hs01_00225295 predicted 1625
12 SASI_Hs01_00225296 predicted 3265
13 SASI_Hs01_00225303 predicted 3317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108544 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239689 predicted 1513
2 SASI_Rn02_00239690 predicted 1391
3 SASI_Rn02_00239691 predicted 956
4 SASI_Rn02_00239692 predicted 710
5 SASI_Rn02_00239693 predicted 801
6 SASI_Rn02_00239694 predicted 1183
7 SASI_Rn02_00239695 predicted 1658
8 SASI_Rn02_00239696 predicted 721
9 SASI_Rn02_00239697 predicted 1792
10 SASI_Rn02_00239698 predicted 1637
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081020 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294418 predicted 2722
2 SASI_Mm02_00294419 predicted 807
3 SASI_Mm02_00294420 predicted 2915
4 SASI_Mm02_00294421 predicted 612
5 SASI_Mm02_00294422 predicted 1475
6 SASI_Mm02_00294423 predicted 2908
7 SASI_Mm02_00294424 predicted 506
8 SASI_Mm02_00294425 predicted 1687
9 SASI_Mm02_00294426 predicted 1456
10 SASI_Mm02_00294427 predicted 3311
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002065 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00211132 predicted 2723
2 SASI_Mm01_00211133 predicted 816
3 SASI_Mm01_00211134 predicted 1313
4 SASI_Mm01_00211135 predicted 620
5 SASI_Mm01_00211136 predicted 1478
6 SASI_Mm01_00211137 predicted 2919
7 SASI_Mm01_00211138 predicted 545
8 SASI_Mm01_00211139 predicted 506
9 SASI_Mm01_00211140 predicted 1692
10 SASI_Mm01_00211141 predicted 1454
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897390 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00283004 predicted 1384
2 SASI_Mm01_00283005 predicted 701
3 SASI_Mm01_00283006 predicted 458
4 SASI_Mm01_00283007 predicted 1161
5 SASI_Mm01_00283008 predicted 1394
6 SASI_Mm01_00283009 predicted 1378
7 SASI_Mm01_00283010 predicted 906
8 SASI_Mm01_00283011 predicted 923
9 SASI_Mm01_00283012 predicted 535
10 SASI_Mm01_00283013 predicted 454
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_197941
ADAMTS6 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197941.1-224s1c1
Sequence:CCGGGCTTAGTTAAAGGTGTCCAAACTCGAGTTTGGACACCTTTAACTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197941.1-471s1c1
Sequence:CCGGGCTGGACTACAGTGGTTGTTTCTCGAGAAACAACCACTGTAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197941.1-198s1c1
Sequence:CCGGGCCCTGTCAGTCTTTAAATTTCTCGAGAAATTTAAAGACTGACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197941.1-904s1c1
Sequence:CCGGGAGTGCAAAGATGTGAATAAACTCGAGTTTATTCACATCTTTGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197941.1-589s1c1
Sequence:CCGGCCAGGATTCAAGCATCGGATTCTCGAGAATCCGATGCTTGAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_197941
ADAMTS6 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197941.1-224s1c1
Sequence:CCGGGCTTAGTTAAAGGTGTCCAAACTCGAGTTTGGACACCTTTAACTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197941.1-471s1c1
Sequence:CCGGGCTGGACTACAGTGGTTGTTTCTCGAGAAACAACCACTGTAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197941.1-198s1c1
Sequence:CCGGGCCCTGTCAGTCTTTAAATTTCTCGAGAAATTTAAAGACTGACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197941.1-904s1c1
Sequence:CCGGGAGTGCAAAGATGTGAATAAACTCGAGTTTATTCACATCTTTGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197941.1-589s1c1
Sequence:CCGGCCAGGATTCAAGCATCGGATTCTCGAGAATCCGATGCTTGAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_197941
ADAMTS6 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197941.1-224s1c1
Sequence:CCGGGCTTAGTTAAAGGTGTCCAAACTCGAGTTTGGACACCTTTAACTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197941.1-471s1c1
Sequence:CCGGGCTGGACTACAGTGGTTGTTTCTCGAGAAACAACCACTGTAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197941.1-198s1c1
Sequence:CCGGGCCCTGTCAGTCTTTAAATTTCTCGAGAAATTTAAAGACTGACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197941.1-904s1c1
Sequence:CCGGGAGTGCAAAGATGTGAATAAACTCGAGTTTATTCACATCTTTGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197941.1-589s1c1
Sequence:CCGGCCAGGATTCAAGCATCGGATTCTCGAGAATCCGATGCTTGAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014273
ADAMTS6 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014273.2-2099s1c1
Sequence:CCGGGCTCTGTTCACATTGAAGTTACTCGAGTAACTTCAATGTGAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014273.2-126s1c1
Sequence:CCGGCCTGACTTATCTTGAACACTACTCGAGTAGTGTTCAAGATAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014273.2-822s1c1
Sequence:CCGGCCGCAAAGACATTGAACATTACTCGAGTAATGTTCAATGTCTTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014273.2-1313s1c1
Sequence:CCGGGCAGCTCACATTACTGCGAATCTCGAGATTCGCAGTAATGTGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014273.2-258s1c1
Sequence:CCGGGCAGGCAGTATCTAAGTTATTCTCGAGAATAACTTAGATACTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014273
ADAMTS6 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014273.2-2099s1c1
Sequence:CCGGGCTCTGTTCACATTGAAGTTACTCGAGTAACTTCAATGTGAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014273.2-126s1c1
Sequence:CCGGCCTGACTTATCTTGAACACTACTCGAGTAGTGTTCAAGATAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014273.2-822s1c1
Sequence:CCGGCCGCAAAGACATTGAACATTACTCGAGTAATGTTCAATGTCTTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014273.2-1313s1c1
Sequence:CCGGGCAGCTCACATTACTGCGAATCTCGAGATTCGCAGTAATGTGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014273.2-258s1c1
Sequence:CCGGGCAGGCAGTATCTAAGTTATTCTCGAGAATAACTTAGATACTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014273
ADAMTS6 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014273.2-2099s1c1
Sequence:CCGGGCTCTGTTCACATTGAAGTTACTCGAGTAACTTCAATGTGAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014273.2-126s1c1
Sequence:CCGGCCTGACTTATCTTGAACACTACTCGAGTAGTGTTCAAGATAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014273.2-822s1c1
Sequence:CCGGCCGCAAAGACATTGAACATTACTCGAGTAATGTTCAATGTCTTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014273.2-1313s1c1
Sequence:CCGGGCAGCTCACATTACTGCGAATCTCGAGATTCGCAGTAATGTGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014273.2-258s1c1
Sequence:CCGGGCAGGCAGTATCTAAGTTATTCTCGAGAATAACTTAGATACTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081020
ADAMTS6 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081020.1-4642s21c1
Sequence:CCGGACCGAGACTCCTTCGTGTTTACTCGAGTAAACACGAAGGAGTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081020.1-862s21c1
Sequence:CCGGTGTTGGATTGCATGGTATTATCTCGAGATAATACCATGCAATCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081020.1-1298s21c1
Sequence:CCGGATTATAGTGGCTCGCTTAATTCTCGAGAATTAAGCGAGCCACTATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081020.1-452s21c1
Sequence:CCGGATCATGGCCTCATCGGAATTTCTCGAGAAATTCCGATGAGGCCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081020.1-1483s21c1
Sequence:CCGGATATGATATCTGCACGTATAACTCGAGTTATACGTGCAGATATCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081020
ADAMTS6 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081020.1-4642s21c1
Sequence:CCGGACCGAGACTCCTTCGTGTTTACTCGAGTAAACACGAAGGAGTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081020.1-862s21c1
Sequence:CCGGTGTTGGATTGCATGGTATTATCTCGAGATAATACCATGCAATCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081020.1-1298s21c1
Sequence:CCGGATTATAGTGGCTCGCTTAATTCTCGAGAATTAAGCGAGCCACTATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081020.1-452s21c1
Sequence:CCGGATCATGGCCTCATCGGAATTTCTCGAGAAATTCCGATGAGGCCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081020.1-1483s21c1
Sequence:CCGGATATGATATCTGCACGTATAACTCGAGTTATACGTGCAGATATCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081020
ADAMTS6 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081020.1-4642s21c1
Sequence:CCGGACCGAGACTCCTTCGTGTTTACTCGAGTAAACACGAAGGAGTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081020.1-862s21c1
Sequence:CCGGTGTTGGATTGCATGGTATTATCTCGAGATAATACCATGCAATCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081020.1-1298s21c1
Sequence:CCGGATTATAGTGGCTCGCTTAATTCTCGAGAATTAAGCGAGCCACTATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081020.1-452s21c1
Sequence:CCGGATCATGGCCTCATCGGAATTTCTCGAGAAATTCCGATGAGGCCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081020.1-1483s21c1
Sequence:CCGGATATGATATCTGCACGTATAACTCGAGTTATACGTGCAGATATCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks