EMAIL THIS PAGE TO A FRIEND

ADAMTS7

ADAM metallopeptidase with thrombospondin type 1 motif, 7

78 Gene Product Result for
Synonyms: ADAM-TS 7 ADAM-TS7 ADAMTS-7
UniProtKB ID: Q9UKP4, Q14F51, Q6P7J9
Gene ID:
Human(11173) Summary: The protein encoded by this gene is a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) family. Members of this family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The protein encoded by this gene contains two C-terminal TS motifs. [provided by RefSeq, Jul 2008]
Mouse(108153) a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 7
Rat(315879) ADAM metallopeptidase with thrombospondin type 1 motif, 7
chicken(415570) ADAM metallopeptidase with thrombospondin type 1 motif, 7
domestic cat(101092185) ADAM metallopeptidase with thrombospondin type 1 motif, 7
dog(488775) ADAM metallopeptidase with thrombospondin type 1 motif, 7
cow(504694) ADAM metallopeptidase with thrombospondin type 1 motif, 7
Domestic Rabbit(100340872) ADAM metallopeptidase with thrombospondin type 1 motif, 7
naked mole-rat(101710586) ADAM metallopeptidase with thrombospondin type 1 motif, 7
domestic guinea pig(100728771) ADAM metallopeptidase with thrombospondin type 1 motif, 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014272 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014272 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014272 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_135041 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_135041 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_135041 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU198771 MISSION® esiRNA esiRNA targeting mouse Adamts7 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014272 Rosetta Predictions human pricing
NM_001047101 Rosetta Predictions rat pricing
NM_001003911 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014272 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064851 predicted 2230
2 SASI_Hs01_00064853 predicted 3100
3 SASI_Hs01_00064854 predicted 3743
4 SASI_Hs01_00064855 predicted 2199
5 SASI_Hs01_00064856 predicted 2207
6 SASI_Hs01_00064857 predicted 1411
7 SASI_Hs01_00064858 predicted 2807
8 SASI_Hs01_00064859 predicted 3024
9 SASI_Hs02_00345343 predicted 2683
10 SASI_Hs02_00345344 predicted 1444
11 SASI_Hs01_00064850 predicted 2736
12 SASI_Hs01_00064852 predicted 1764
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047101 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205944 predicted 4770
2 SASI_Rn02_00205945 predicted 3999
3 SASI_Rn02_00205946 predicted 3831
4 SASI_Rn02_00205947 predicted 1179
5 SASI_Rn02_00205948 predicted 3964
6 SASI_Rn02_00205949 predicted 4209
7 SASI_Rn02_00205950 predicted 3560
8 SASI_Rn02_00205951 predicted 1599
9 SASI_Rn02_00205952 predicted 550
10 SASI_Rn02_00205953 predicted 3380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003911 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159841 predicted 959
2 SASI_Mm01_00159842 predicted 983
3 SASI_Mm01_00159843 predicted 2383
4 SASI_Mm01_00159845 predicted 825
5 SASI_Mm01_00159846 predicted 558
6 SASI_Mm01_00159847 predicted 3253
7 SASI_Mm01_00159848 predicted 1081
8 SASI_Mm01_00159849 predicted 2668
9 SASI_Mm02_00286352 predicted 4462
10 SASI_Mm01_00159850 predicted 2793
11 SASI_Mm01_00159844 predicted 2846
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014272
ADAMTS7 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014272.3-2673s21c1
Sequence:CCGGCCGTGTTCTCCTGGCATTATGCTCGAGCATAATGCCAGGAGAACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014272.3-1603s21c1
Sequence:CCGGTGGCGTCCTCTATGATGTAAGCTCGAGCTTACATCATAGAGGACGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014272.3-3421s21c1
Sequence:CCTGCAATTTCCACGAGGATCTGTCCTCGAGGACAGATCCTCGTGGAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014272.3-2216s21c1
Sequence:CCGGTGTAAGAACGTGGGCTGTGACCTCGAGGTCACAGCCCACGTTCTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014272.3-1513s21c1
Sequence:CCGGGTATATCACCAGGTTCCTTGACTCGAGTCAAGGAACCTGGTGATATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014272.2-2441s1c1
Sequence:CCGGCCGGAGAAGTACTTCCTCAATCTCGAGATTGAGGAAGTACTTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014272.2-1918s1c1
Sequence:CCGGGCCCAAATACAAAGGCAGATACTCGAGTATCTGCCTTTGTATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014272.2-1432s1c1
Sequence:CCGGCGTTGGGAAACGACCTTTCATCTCGAGATGAAAGGTCGTTTCCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014272.2-4984s1c1
Sequence:CCGGGCGCCTGGTCAAGTGTGTCAACTCGAGTTGACACACTTGACCAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014272.2-446s1c1
Sequence:CCGGCCCGCCTTCTACGAGCTACAACTCGAGTTGTAGCTCGTAGAAGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014272
ADAMTS7 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014272.3-2673s21c1
Sequence:CCGGCCGTGTTCTCCTGGCATTATGCTCGAGCATAATGCCAGGAGAACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014272.3-1603s21c1
Sequence:CCGGTGGCGTCCTCTATGATGTAAGCTCGAGCTTACATCATAGAGGACGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014272.3-3421s21c1
Sequence:CCTGCAATTTCCACGAGGATCTGTCCTCGAGGACAGATCCTCGTGGAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014272.3-2216s21c1
Sequence:CCGGTGTAAGAACGTGGGCTGTGACCTCGAGGTCACAGCCCACGTTCTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014272.3-1513s21c1
Sequence:CCGGGTATATCACCAGGTTCCTTGACTCGAGTCAAGGAACCTGGTGATATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014272.2-2441s1c1
Sequence:CCGGCCGGAGAAGTACTTCCTCAATCTCGAGATTGAGGAAGTACTTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014272.2-1918s1c1
Sequence:CCGGGCCCAAATACAAAGGCAGATACTCGAGTATCTGCCTTTGTATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014272.2-1432s1c1
Sequence:CCGGCGTTGGGAAACGACCTTTCATCTCGAGATGAAAGGTCGTTTCCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014272.2-4984s1c1
Sequence:CCGGGCGCCTGGTCAAGTGTGTCAACTCGAGTTGACACACTTGACCAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014272.2-446s1c1
Sequence:CCGGCCCGCCTTCTACGAGCTACAACTCGAGTTGTAGCTCGTAGAAGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014272
ADAMTS7 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014272.3-2673s21c1
Sequence:CCGGCCGTGTTCTCCTGGCATTATGCTCGAGCATAATGCCAGGAGAACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014272.3-1603s21c1
Sequence:CCGGTGGCGTCCTCTATGATGTAAGCTCGAGCTTACATCATAGAGGACGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014272.3-3421s21c1
Sequence:CCTGCAATTTCCACGAGGATCTGTCCTCGAGGACAGATCCTCGTGGAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014272.3-2216s21c1
Sequence:CCGGTGTAAGAACGTGGGCTGTGACCTCGAGGTCACAGCCCACGTTCTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014272.3-1513s21c1
Sequence:CCGGGTATATCACCAGGTTCCTTGACTCGAGTCAAGGAACCTGGTGATATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014272.2-2441s1c1
Sequence:CCGGCCGGAGAAGTACTTCCTCAATCTCGAGATTGAGGAAGTACTTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014272.2-1918s1c1
Sequence:CCGGGCCCAAATACAAAGGCAGATACTCGAGTATCTGCCTTTGTATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014272.2-1432s1c1
Sequence:CCGGCGTTGGGAAACGACCTTTCATCTCGAGATGAAAGGTCGTTTCCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014272.2-4984s1c1
Sequence:CCGGGCGCCTGGTCAAGTGTGTCAACTCGAGTTGACACACTTGACCAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014272.2-446s1c1
Sequence:CCGGCCCGCCTTCTACGAGCTACAACTCGAGTTGTAGCTCGTAGAAGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_135041
ADAMTS7 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_135041.5-2510s1c1
Sequence:CCGGGAGGACTGTGAACTGGTTGAACTCGAGTTCAACCAGTTCACAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135041.5-1929s1c1
Sequence:CCGGGCCTAAGAACAGAGGCAAGTACTCGAGTACTTGCCTCTGTTCTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135041.5-924s1c1
Sequence:CCGGGCGATCAGTCAGCAAAGAGAACTCGAGTTCTCTTTGCTGACTGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135041.5-1176s1c1
Sequence:CCGGGTGGCAGAAGAACATTAACATCTCGAGATGTTAATGTTCTTCTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135041.5-1093s1c1
Sequence:CCGGGTGCGCCTTATCATACTGGAACTCGAGTTCCAGTATGATAAGGCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_135041
ADAMTS7 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_135041.5-2510s1c1
Sequence:CCGGGAGGACTGTGAACTGGTTGAACTCGAGTTCAACCAGTTCACAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135041.5-1929s1c1
Sequence:CCGGGCCTAAGAACAGAGGCAAGTACTCGAGTACTTGCCTCTGTTCTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135041.5-924s1c1
Sequence:CCGGGCGATCAGTCAGCAAAGAGAACTCGAGTTCTCTTTGCTGACTGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135041.5-1176s1c1
Sequence:CCGGGTGGCAGAAGAACATTAACATCTCGAGATGTTAATGTTCTTCTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135041.5-1093s1c1
Sequence:CCGGGTGCGCCTTATCATACTGGAACTCGAGTTCCAGTATGATAAGGCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_135041
ADAMTS7 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_135041.5-2510s1c1
Sequence:CCGGGAGGACTGTGAACTGGTTGAACTCGAGTTCAACCAGTTCACAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135041.5-1929s1c1
Sequence:CCGGGCCTAAGAACAGAGGCAAGTACTCGAGTACTTGCCTCTGTTCTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135041.5-924s1c1
Sequence:CCGGGCGATCAGTCAGCAAAGAGAACTCGAGTTCTCTTTGCTGACTGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135041.5-1176s1c1
Sequence:CCGGGTGGCAGAAGAACATTAACATCTCGAGATGTTAATGTTCTTCTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135041.5-1093s1c1
Sequence:CCGGGTGCGCCTTATCATACTGGAACTCGAGTTCCAGTATGATAAGGCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks