EMAIL THIS PAGE TO A FRIEND

ADAMTS8

ADAM metallopeptidase with thrombospondin type 1 motif, 8

87 Gene Product Result for
Synonyms: ADAM-TS8 METH2
UniProtKB ID: Q9UP79, Q9NZS0
Gene ID:
Human(11095) Summary: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The enzyme encoded by this gene contains two C-terminal TS motifs, and disrupts angiogenesis in vivo. A number of disorders have been mapped in the vicinity of this gene, most notably lung neoplasms. [provided by RefSeq, Jul 2008]
Mouse(30806) a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 8
Rat(300475) ADAM metallopeptidase with thrombospondin type 1 motif, 8
domestic guinea pig(100712934) ADAM metallopeptidase with thrombospondin type 1 motif, 8
naked mole-rat(101699898) ADAM metallopeptidase with thrombospondin type 1 motif, 8
sheep(101120031) ADAM metallopeptidase with thrombospondin type 1 motif, 8
chicken(769222) ADAM metallopeptidase with thrombospondin type 1 motif, 8
dog(100684302) ADAM metallopeptidase with thrombospondin type 1 motif, 8
cow(512544) ADAM metallopeptidase with thrombospondin type 1 motif, 8
domestic cat(101096009) ADAM metallopeptidase with thrombospondin type 1 motif, 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007037 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007037 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007037 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013906 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013906 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013906 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007037 Rosetta Predictions human pricing
NM_001106811 Rosetta Predictions rat pricing
NM_013906 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007037 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164704 predicted 2539
2 SASI_Hs01_00164705 predicted 2705
3 SASI_Hs01_00164706 predicted 1137
4 SASI_Hs01_00164707 predicted 1714
5 SASI_Hs01_00164708 predicted 1518
6 SASI_Hs01_00164709 predicted 2274
7 SASI_Hs01_00164710 predicted 1495
8 SASI_Hs01_00164711 predicted 2985
9 SASI_Hs01_00164712 predicted 1215
10 SASI_Hs01_00164713 predicted 2443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106811 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222638 predicted 592
2 SASI_Rn02_00222639 predicted 401
3 SASI_Rn02_00222640 predicted 712
4 SASI_Rn02_00222641 predicted 873
5 SASI_Rn02_00222642 predicted 336
6 SASI_Rn02_00222643 predicted 415
7 SASI_Rn02_00222644 predicted 635
8 SASI_Rn02_00222645 predicted 337
9 SASI_Rn02_00222646 predicted 488
10 SASI_Rn02_00222647 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013906 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185935 predicted 1973
2 SASI_Mm01_00185936 predicted 3006
3 SASI_Mm01_00185937 predicted 3018
4 SASI_Mm01_00185938 predicted 1671
5 SASI_Mm01_00185939 predicted 2327
6 SASI_Mm01_00185940 predicted 2223
7 SASI_Mm01_00185941 predicted 2015
8 SASI_Mm01_00185942 predicted 1754
9 SASI_Mm01_00185943 predicted 2997
10 SASI_Mm01_00185944 predicted 893
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007037
ADAMTS8 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 8
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007037.2-2802s1c1
Sequence:CCGGCCCACCAATTATGGCTACAATCTCGAGATTGTAGCCATAATTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007037.2-2477s1c1
Sequence:CCGGGCAGCAGTGTGAGAAGTATAACTCGAGTTATACTTCTCACACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007037.2-3132s1c1
Sequence:CCGGGTTCCTAATGACGTGGACTTTCTCGAGAAAGTCCACGTCATTAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007037.4-2157s21c1
Sequence:CCGGACACTGACATGGACGGGAATCCTCGAGGATTCCCGTCCATGTCAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007037.4-982s21c1
Sequence:CCGGGAGTAGGACCAAGCGGTTTGTCTCGAGACAAACCGCTTGGTCCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007037.4-3338s21c1
Sequence:CCGGGCAAAGGACTAGCAAACTTAACTCGAGTTAAGTTTGCTAGTCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007037
ADAMTS8 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 8
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007037.2-2802s1c1
Sequence:CCGGCCCACCAATTATGGCTACAATCTCGAGATTGTAGCCATAATTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007037.2-2477s1c1
Sequence:CCGGGCAGCAGTGTGAGAAGTATAACTCGAGTTATACTTCTCACACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007037.2-3132s1c1
Sequence:CCGGGTTCCTAATGACGTGGACTTTCTCGAGAAAGTCCACGTCATTAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007037.4-2157s21c1
Sequence:CCGGACACTGACATGGACGGGAATCCTCGAGGATTCCCGTCCATGTCAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007037.4-982s21c1
Sequence:CCGGGAGTAGGACCAAGCGGTTTGTCTCGAGACAAACCGCTTGGTCCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007037.4-3338s21c1
Sequence:CCGGGCAAAGGACTAGCAAACTTAACTCGAGTTAAGTTTGCTAGTCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007037
ADAMTS8 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 8
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007037.2-2802s1c1
Sequence:CCGGCCCACCAATTATGGCTACAATCTCGAGATTGTAGCCATAATTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007037.2-2477s1c1
Sequence:CCGGGCAGCAGTGTGAGAAGTATAACTCGAGTTATACTTCTCACACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007037.2-3132s1c1
Sequence:CCGGGTTCCTAATGACGTGGACTTTCTCGAGAAAGTCCACGTCATTAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007037.4-2157s21c1
Sequence:CCGGACACTGACATGGACGGGAATCCTCGAGGATTCCCGTCCATGTCAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007037.4-982s21c1
Sequence:CCGGGAGTAGGACCAAGCGGTTTGTCTCGAGACAAACCGCTTGGTCCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007037.4-3338s21c1
Sequence:CCGGGCAAAGGACTAGCAAACTTAACTCGAGTTAAGTTTGCTAGTCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013906
ADAMTS8 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 8
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032094    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013906.1-3294s1c1
Sequence:CCGGGCAAAGGACTAGCAAAGCTAACTCGAGTTAGCTTTGCTAGTCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013906.1-1975s1c1
Sequence:CCGGCCGTGAATGTGATAATCCAATCTCGAGATTGGATTATCACATTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013906.1-974s1c1
Sequence:CCGGGCTCGCTTCGTGGAAACACTTCTCGAGAAGTGTTTCCACGAAGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013906.1-2417s1c1
Sequence:CCGGCCCTTCAGTTATGGCTACAATCTCGAGATTGTAGCCATAACTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013906.1-2769s1c1
Sequence:CCGGGCGTGCAGAATAGCAAGGAAACTCGAGTTTCCTTGCTATTCTGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013906.2-1449s21c1
Sequence:CCGGAGCCCTGTGTGAGATTGTTTGCTCGAGCAAACAATCTCACACAGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013906.2-1407s21c1
Sequence:CCGGATGAGCTAGGGCACGTTCTCACTCGAGTGAGAACGTGCCCTAGCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013906
ADAMTS8 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 8
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032094    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013906.1-3294s1c1
Sequence:CCGGGCAAAGGACTAGCAAAGCTAACTCGAGTTAGCTTTGCTAGTCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013906.1-1975s1c1
Sequence:CCGGCCGTGAATGTGATAATCCAATCTCGAGATTGGATTATCACATTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013906.1-974s1c1
Sequence:CCGGGCTCGCTTCGTGGAAACACTTCTCGAGAAGTGTTTCCACGAAGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013906.1-2417s1c1
Sequence:CCGGCCCTTCAGTTATGGCTACAATCTCGAGATTGTAGCCATAACTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013906.1-2769s1c1
Sequence:CCGGGCGTGCAGAATAGCAAGGAAACTCGAGTTTCCTTGCTATTCTGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013906.2-1449s21c1
Sequence:CCGGAGCCCTGTGTGAGATTGTTTGCTCGAGCAAACAATCTCACACAGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013906.2-1407s21c1
Sequence:CCGGATGAGCTAGGGCACGTTCTCACTCGAGTGAGAACGTGCCCTAGCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013906
ADAMTS8 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 8
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032094    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013906.1-3294s1c1
Sequence:CCGGGCAAAGGACTAGCAAAGCTAACTCGAGTTAGCTTTGCTAGTCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013906.1-1975s1c1
Sequence:CCGGCCGTGAATGTGATAATCCAATCTCGAGATTGGATTATCACATTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013906.1-974s1c1
Sequence:CCGGGCTCGCTTCGTGGAAACACTTCTCGAGAAGTGTTTCCACGAAGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013906.1-2417s1c1
Sequence:CCGGCCCTTCAGTTATGGCTACAATCTCGAGATTGTAGCCATAACTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013906.1-2769s1c1
Sequence:CCGGGCGTGCAGAATAGCAAGGAAACTCGAGTTTCCTTGCTATTCTGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013906.2-1449s21c1
Sequence:CCGGAGCCCTGTGTGAGATTGTTTGCTCGAGCAAACAATCTCACACAGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013906.2-1407s21c1
Sequence:CCGGATGAGCTAGGGCACGTTCTCACTCGAGTGAGAACGTGCCCTAGCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks