EMAIL THIS PAGE TO A FRIEND

ADAMTS9

ADAM metallopeptidase with thrombospondin type 1 motif, 9

58 Gene Product Result for
UniProtKB ID: Q9P2N4, A1L4L0, B9ZVN0, Q9NR29
Gene ID:
Human(56999) Summary: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. Members of the ADAMTS family have been implicated in the cleavage of proteoglycans, the control of organ shape during development, and the inhibition of angiogenesis. This gene is localized to chromosome 3p14.3-p14.2, an area known to be lost in hereditary renal tumors. [provided by RefSeq, Jul 2008]
Mouse(101401) a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 9
Rat(312566) ADAM metallopeptidase with thrombospondin type 1 motif, 9
Zebrafish(100333407) ADAM metallopeptidase with thrombospondin type 1 motif, 9
cow(537051) ADAM metallopeptidase with thrombospondin type 1 motif, 9
Horse(100049887) ADAM metallopeptidase with thrombospondin type 1 motif, 9
domestic cat(101085359) ADAM metallopeptidase with thrombospondin type 1 motif, 9
dog(606847) ADAM metallopeptidase with thrombospondin type 1 motif, 9
chicken(416080) ADAM metallopeptidase with thrombospondin type 1 motif, 9
sheep(101119080) ADAM metallopeptidase with thrombospondin type 1 motif, 9
Domestic Rabbit(100339560) ADAM metallopeptidase with thrombospondin type 1 motif, 9
naked mole-rat(101700071) ADAM metallopeptidase with thrombospondin type 1 motif, 9
domestic guinea pig(100716047) ADAM metallopeptidase with thrombospondin type 1 motif, 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182920 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182920 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182920 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020249 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020249 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020249 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182920 Rosetta Predictions human pricing
NM_001107877 Rosetta Predictions rat pricing
NM_175314 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182920 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132394 predicted 5163
2 SASI_Hs01_00132395 predicted 5211
3 SASI_Hs01_00132396 predicted 1262
4 SASI_Hs01_00132397 predicted 2267
5 SASI_Hs01_00132398 predicted 3475
6 SASI_Hs01_00132400 predicted 769
7 SASI_Hs01_00132401 predicted 2396
8 SASI_Hs01_00132402 predicted 3573
9 SASI_Hs01_00132403 predicted 806
10 SASI_Hs02_00371041 predicted 3427
11 SASI_Hs01_00132399 predicted 2258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107877 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233165 predicted 5359
2 SASI_Rn02_00233166 predicted 3088
3 SASI_Rn02_00233167 predicted 4349
4 SASI_Rn02_00233168 predicted 1361
5 SASI_Rn02_00233169 predicted 1200
6 SASI_Rn02_00233170 predicted 3900
7 SASI_Rn02_00233171 predicted 1074
8 SASI_Rn02_00233172 predicted 4601
9 SASI_Rn02_00233173 predicted 2194
10 SASI_Rn02_00233174 predicted 2948
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175314 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346080 predicted 1402
2 SASI_Mm02_00346081 predicted 3869
3 SASI_Mm02_00346082 predicted 642
4 SASI_Mm02_00346083 predicted 588
5 SASI_Mm02_00346084 predicted 1600
6 SASI_Mm02_00346085 predicted 2466
7 SASI_Mm02_00346086 predicted 1355
8 SASI_Mm02_00346087 predicted 3695
9 SASI_Mm02_00346088 predicted 2102
10 SASI_Mm02_00346089 predicted 731
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182920
ADAMTS9 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 9
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182920.1-2042s21c1
Sequence:CCGGTGTGCGCTGGGTCCCTAAATACTCGAGTATTTAGGGACCCAGCGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182920.1-3272s21c1
Sequence:CCGGGTTTGGTGAAGATCGATTAAACTCGAGTTTAATCGATCTTCACCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182920.1-371s21c1
Sequence:CCGGCACCGCCAATGCCGGATTTATCTCGAGATAAATCCGGCATTGGCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182920.1-3431s21c1
Sequence:CCGGATGCATCATTGGGACTTATATCTCGAGATATAAGTCCCAATGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182920.1-6256s21c1
Sequence:CCGGCCATCATCAAGGTGCTATAAGCTCGAGCTTATAGCACCTTGATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182920.1-2401s21c1
Sequence:CCGGCAGACGATGACAACTACTTAGCTCGAGCTAAGTAGTTGTCATCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182920.1-999s21c1
Sequence:CCGGATTGTAGCCTCTATCTATAAACTCGAGTTTATAGATAGAGGCTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182920.1-1567s21c1
Sequence:CCGGGCATCCTTTACAACGTGAATACTCGAGTATTCACGTTGTAAAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182920
ADAMTS9 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 9
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182920.1-2042s21c1
Sequence:CCGGTGTGCGCTGGGTCCCTAAATACTCGAGTATTTAGGGACCCAGCGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182920.1-3272s21c1
Sequence:CCGGGTTTGGTGAAGATCGATTAAACTCGAGTTTAATCGATCTTCACCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182920.1-371s21c1
Sequence:CCGGCACCGCCAATGCCGGATTTATCTCGAGATAAATCCGGCATTGGCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182920.1-3431s21c1
Sequence:CCGGATGCATCATTGGGACTTATATCTCGAGATATAAGTCCCAATGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182920.1-6256s21c1
Sequence:CCGGCCATCATCAAGGTGCTATAAGCTCGAGCTTATAGCACCTTGATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182920.1-2401s21c1
Sequence:CCGGCAGACGATGACAACTACTTAGCTCGAGCTAAGTAGTTGTCATCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182920.1-999s21c1
Sequence:CCGGATTGTAGCCTCTATCTATAAACTCGAGTTTATAGATAGAGGCTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182920.1-1567s21c1
Sequence:CCGGGCATCCTTTACAACGTGAATACTCGAGTATTCACGTTGTAAAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182920
ADAMTS9 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 9
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182920.1-2042s21c1
Sequence:CCGGTGTGCGCTGGGTCCCTAAATACTCGAGTATTTAGGGACCCAGCGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182920.1-3272s21c1
Sequence:CCGGGTTTGGTGAAGATCGATTAAACTCGAGTTTAATCGATCTTCACCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182920.1-371s21c1
Sequence:CCGGCACCGCCAATGCCGGATTTATCTCGAGATAAATCCGGCATTGGCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182920.1-3431s21c1
Sequence:CCGGATGCATCATTGGGACTTATATCTCGAGATATAAGTCCCAATGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182920.1-6256s21c1
Sequence:CCGGCCATCATCAAGGTGCTATAAGCTCGAGCTTATAGCACCTTGATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182920.1-2401s21c1
Sequence:CCGGCAGACGATGACAACTACTTAGCTCGAGCTAAGTAGTTGTCATCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182920.1-999s21c1
Sequence:CCGGATTGTAGCCTCTATCTATAAACTCGAGTTTATAGATAGAGGCTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182920.1-1567s21c1
Sequence:CCGGGCATCCTTTACAACGTGAATACTCGAGTATTCACGTTGTAAAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020249
ADAMTS9 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase with thrombospondin type 1 motif, 9
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020249.2-2536s1c1
Sequence:CCGGCCGTAGAAAGAATTAACTCAACTCGAGTTGAGTTAATTCTTTCTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020249.2-1282s1c1
Sequence:CCGGGCTGTTCTATTAGTGAAGATACTCGAGTATCTTCACTAATAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020249.2-1006s1c1
Sequence:CCGGCCTCTATCTATAAAGACCCAACTCGAGTTGGGTCTTTATAGATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020249.2-3142s1c1
Sequence:CCGGGCACACATCAAGAGAAAGTTACTCGAGTAACTTTCTCTTGATGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020249.2-347s1c1
Sequence:CCGGCGGCCAGCAGTTTCTATTTAACTCGAGTTAAATAGAAACTGCTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020249
ADAMTS9 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase with thrombospondin type 1 motif, 9
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020249.2-2536s1c1
Sequence:CCGGCCGTAGAAAGAATTAACTCAACTCGAGTTGAGTTAATTCTTTCTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020249.2-1282s1c1
Sequence:CCGGGCTGTTCTATTAGTGAAGATACTCGAGTATCTTCACTAATAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020249.2-1006s1c1
Sequence:CCGGCCTCTATCTATAAAGACCCAACTCGAGTTGGGTCTTTATAGATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020249.2-3142s1c1
Sequence:CCGGGCACACATCAAGAGAAAGTTACTCGAGTAACTTTCTCTTGATGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020249.2-347s1c1
Sequence:CCGGCGGCCAGCAGTTTCTATTTAACTCGAGTTAAATAGAAACTGCTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020249
ADAMTS9 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase with thrombospondin type 1 motif, 9
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020249.2-2536s1c1
Sequence:CCGGCCGTAGAAAGAATTAACTCAACTCGAGTTGAGTTAATTCTTTCTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020249.2-1282s1c1
Sequence:CCGGGCTGTTCTATTAGTGAAGATACTCGAGTATCTTCACTAATAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020249.2-1006s1c1
Sequence:CCGGCCTCTATCTATAAAGACCCAACTCGAGTTGGGTCTTTATAGATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020249.2-3142s1c1
Sequence:CCGGGCACACATCAAGAGAAAGTTACTCGAGTAACTTTCTCTTGATGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020249.2-347s1c1
Sequence:CCGGCGGCCAGCAGTTTCTATTTAACTCGAGTTAAATAGAAACTGCTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks