EMAIL THIS PAGE TO A FRIEND

ADAMTSL1

ADAMTS-like 1

Synonyms: ADAMTSL-1 ADAMTSR1 C9orf94 PUNCTIN
Gene ID:
Human(92949) Summary: This gene encodes a secreted protein and member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) family. This protein lacks the metalloproteinase and disintegrin-like domains, which are typical of the ADAMTS family, but contains other ADAMTS domains, including the thrombospondin type 1 motif. This protein may have important functions in the extracellular matrix. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2008]
Mouse(77739) ADAMTS-like 1
Rat(362539) ADAMTS-like 1
chicken(431603) ADAMTS-like 1
domestic cat(101082271) ADAMTS-like 1
cow(530624) ADAMTS-like 1
Horse(100063467) ADAMTS-like 1
dog(474717) ADAMTS-like 1
sheep(101122835) ADAMTS-like 1
207 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052866 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052866 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052866 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172542 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172542 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172542 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU040861 MISSION® esiRNA esiRNA targeting mouse Adamtsl1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040272 Rosetta Predictions human pricing
NM_052866 Rosetta Predictions human pricing
NM_139238 Rosetta Predictions human pricing
NM_139264 Rosetta Predictions human pricing
XM_342858 Rosetta Predictions rat pricing
NM_029967 Rosetta Predictions mouse pricing
NM_172542 Rosetta Predictions mouse pricing
XM_890583 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040272 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308912 predicted 535
2 SASI_Hs02_00308913 predicted 855
3 SASI_Hs02_00308914 predicted 402
4 SASI_Hs02_00308915 predicted 725
5 SASI_Hs02_00308916 predicted 757
6 SASI_Hs02_00308917 predicted 499
7 SASI_Hs02_00308918 predicted 534
8 SASI_Hs02_00308919 predicted 752
9 SASI_Hs02_00308920 predicted 573
10 SASI_Hs02_00308921 predicted 979
11 SASI_Hs01_00197957 predicted 556
12 SASI_Hs01_00197958 predicted 1559
13 SASI_Hs01_00197959 predicted 1452
14 SASI_Hs01_00197960 predicted 1874
15 SASI_Hs01_00197961 predicted 1444
16 SASI_Hs01_00197962 predicted 490
17 SASI_Hs01_00197963 predicted 647
18 SASI_Hs01_00197964 predicted 1966
19 SASI_Hs01_00197965 predicted 1009
20 SASI_Hs01_00197966 predicted 1719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052866 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176250 predicted 537
2 SASI_Hs02_00361564 predicted 854
3 SASI_Hs01_00176251 predicted 410
4 SASI_Hs01_00176252 predicted 722
5 SASI_Hs01_00176254 predicted 765
6 SASI_Hs01_00176255 predicted 502
7 SASI_Hs01_00176256 predicted 533
8 SASI_Hs01_00176257 predicted 751
9 SASI_Hs01_00176258 predicted 570
10 SASI_Hs01_00176259 predicted 977
11 SASI_Hs01_00176253 predicted 281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139238 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060154 predicted 480
2 SASI_Hs01_00060155 predicted 352
3 SASI_Hs01_00060156 predicted 669
4 SASI_Hs01_00060157 predicted 282
5 SASI_Hs01_00060158 predicted 703
6 SASI_Hs01_00060159 predicted 439
7 SASI_Hs01_00060160 predicted 480
8 SASI_Hs01_00060161 predicted 692
9 SASI_Hs01_00060162 predicted 511
10 SASI_Hs01_00060163 predicted 920
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139264 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201521 predicted 485
2 SASI_Hs01_00201522 predicted 351
3 SASI_Hs01_00201523 predicted 663
4 SASI_Hs01_00201524 predicted 280
5 SASI_Hs01_00201525 predicted 705
6 SASI_Hs01_00201526 predicted 446
7 SASI_Hs01_00201527 predicted 474
8 SASI_Hs01_00201528 predicted 690
9 SASI_Hs01_00201529 predicted 516
10 SASI_Hs01_00201530 predicted 929
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342858 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394911 predicted 798
2 SASI_Rn02_00394912 predicted 970
3 SASI_Rn02_00394913 predicted 881
4 SASI_Rn02_00394914 predicted 966
5 SASI_Rn02_00394915 predicted 960
6 SASI_Rn02_00394916 predicted 1010
7 SASI_Rn02_00394917 predicted 795
8 SASI_Rn02_00394918 predicted 731
9 SASI_Rn02_00394919 predicted 741
10 SASI_Rn02_00394920 predicted 892
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029967 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336284 predicted 5187
2 SASI_Mm02_00336285 predicted 549
3 SASI_Mm02_00336286 predicted 419
4 SASI_Mm02_00336287 predicted 356
5 SASI_Mm02_00336288 predicted 3865
6 SASI_Mm02_00336289 predicted 3900
7 SASI_Mm02_00336290 predicted 1865
8 SASI_Mm02_00336291 predicted 4286
9 SASI_Mm02_00336292 predicted 3768
10 SASI_Mm02_00336293 predicted 4622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172542 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102357 predicted 1803
2 SASI_Mm01_00102358 predicted 491
3 SASI_Mm01_00102359 predicted 1434
4 SASI_Mm01_00102360 predicted 476
5 SASI_Mm01_00102361 predicted 513
6 SASI_Mm01_00102362 predicted 893
7 SASI_Mm01_00102363 predicted 373
8 SASI_Mm01_00102364 predicted 529
9 SASI_Mm01_00102365 predicted 1229
10 SASI_Mm01_00102366 predicted 552
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_890583 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00210538 predicted 460
2 SASI_Mm01_00210539 predicted 304
3 SASI_Mm01_00210540 predicted 313
4 SASI_Mm01_00210541 predicted 394
5 SASI_Mm01_00210542 predicted 387
6 SASI_Mm01_00210543 predicted 323
7 SASI_Mm01_00210544 predicted 292
8 SASI_Mm01_00210545 predicted 423
9 SASI_Mm01_00210546 predicted 313
10 SASI_Mm01_00210547 predicted 468
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052866
ADAMTSL1 MISSION shRNA Bacterial Glycerol Stock
ADAMTS-like 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052866.2-489s1c1
Sequence:CCGGCGCGTTGCTATACAGAATCTTCTCGAGAAGATTCTGTATAGCAACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052866.2-277s1c1
Sequence:CCGGCCGATACAGAACATGCAGTAACTCGAGTTACTGCATGTTCTGTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052866.2-881s1c1
Sequence:CCGGGCAGATTTCATTGTCAAGATTCTCGAGAATCTTGACAATGAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052866.2-490s1c1
Sequence:CCGGGCGTTGCTATACAGAATCTTTCTCGAGAAAGATTCTGTATAGCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052866.2-654s1c1
Sequence:CCGGCCGCAACCAAATCGGATGATACTCGAGTATCATCCGATTTGGTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052866
ADAMTSL1 MISSION shRNA shRNA Plasmid DNA
ADAMTS-like 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052866.2-489s1c1
Sequence:CCGGCGCGTTGCTATACAGAATCTTCTCGAGAAGATTCTGTATAGCAACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052866.2-277s1c1
Sequence:CCGGCCGATACAGAACATGCAGTAACTCGAGTTACTGCATGTTCTGTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052866.2-881s1c1
Sequence:CCGGGCAGATTTCATTGTCAAGATTCTCGAGAATCTTGACAATGAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052866.2-490s1c1
Sequence:CCGGGCGTTGCTATACAGAATCTTTCTCGAGAAAGATTCTGTATAGCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052866.2-654s1c1
Sequence:CCGGCCGCAACCAAATCGGATGATACTCGAGTATCATCCGATTTGGTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052866
ADAMTSL1 MISSION shRNA Lentiviral Transduction Particles
ADAMTS-like 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052866.2-489s1c1
Sequence:CCGGCGCGTTGCTATACAGAATCTTCTCGAGAAGATTCTGTATAGCAACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052866.2-277s1c1
Sequence:CCGGCCGATACAGAACATGCAGTAACTCGAGTTACTGCATGTTCTGTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052866.2-881s1c1
Sequence:CCGGGCAGATTTCATTGTCAAGATTCTCGAGAATCTTGACAATGAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052866.2-490s1c1
Sequence:CCGGGCGTTGCTATACAGAATCTTTCTCGAGAAAGATTCTGTATAGCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052866.2-654s1c1
Sequence:CCGGCCGCAACCAAATCGGATGATACTCGAGTATCATCCGATTTGGTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172542
ADAMTSL1 MISSION shRNA Bacterial Glycerol Stock
ADAMTS-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172542.1-385s1c1
Sequence:CCGGGCCAGATGATTCCTTACAGATCTCGAGATCTGTAAGGAATCATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172542.1-594s1c1
Sequence:CCGGGAGGAGTGAATGTGACAATTACTCGAGTAATTGTCACATTCACTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172542.1-3648s1c1
Sequence:CCGGGCCTGGAAGTTAAGTTTGAAACTCGAGTTTCAAACTTAACTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172542.1-1878s1c1
Sequence:CCGGGCAACGTCACTCCATGTGAAACTCGAGTTTCACATGGAGTGACGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172542.1-593s1c1
Sequence:CCGGCGAGGAGTGAATGTGACAATTCTCGAGAATTGTCACATTCACTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172542
ADAMTSL1 MISSION shRNA shRNA Plasmid DNA
ADAMTS-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172542.1-385s1c1
Sequence:CCGGGCCAGATGATTCCTTACAGATCTCGAGATCTGTAAGGAATCATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172542.1-594s1c1
Sequence:CCGGGAGGAGTGAATGTGACAATTACTCGAGTAATTGTCACATTCACTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172542.1-3648s1c1
Sequence:CCGGGCCTGGAAGTTAAGTTTGAAACTCGAGTTTCAAACTTAACTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172542.1-1878s1c1
Sequence:CCGGGCAACGTCACTCCATGTGAAACTCGAGTTTCACATGGAGTGACGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172542.1-593s1c1
Sequence:CCGGCGAGGAGTGAATGTGACAATTCTCGAGAATTGTCACATTCACTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172542
ADAMTSL1 MISSION shRNA Lentiviral Transduction Particles
ADAMTS-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172542.1-385s1c1
Sequence:CCGGGCCAGATGATTCCTTACAGATCTCGAGATCTGTAAGGAATCATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172542.1-594s1c1
Sequence:CCGGGAGGAGTGAATGTGACAATTACTCGAGTAATTGTCACATTCACTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172542.1-3648s1c1
Sequence:CCGGGCCTGGAAGTTAAGTTTGAAACTCGAGTTTCAAACTTAACTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172542.1-1878s1c1
Sequence:CCGGGCAACGTCACTCCATGTGAAACTCGAGTTTCACATGGAGTGACGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172542.1-593s1c1
Sequence:CCGGCGAGGAGTGAATGTGACAATTCTCGAGAATTGTCACATTCACTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks