EMAIL THIS PAGE TO A FRIEND

ADAMTSL2

ADAMTS-like 2

61 Gene Product Result for
Synonyms: GPHYSD1
UniProtKB ID: Q86TH1, B1B0D5, O60345
Gene ID:
Human(9719) Summary: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) and ADAMTS-like protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The protein encoded by this gene lacks the protease domain, and is therefore of a member of the the ADAMTS-like protein subfamily. It is a secreted glycoprotein that binds the cell surface and extracellular matrix; it also interacts with latent transforming growth factor beta binding protein 1. Mutations in this gene have been associated with geleophysic dysplasia. [provided by RefSeq, Feb 2009]
Mouse(77794) ADAMTS-like 2
Rat(311827) ADAMTS-like 2
sheep(101111183) ADAMTS-like 2
Zebrafish(100537087) ADAMTS-like 2
chicken(417147) ADAMTS-like 2
cow(526780) ADAMTS-like 2
Horse(100066494) ADAMTS-like 2
domestic cat(101086513) ADAMTS-like 2
dog(491276) ADAMTS-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_130065 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_130065 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_130065 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014694 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014694 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014694 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU069401 MISSION® esiRNA esiRNA human ADAMTSL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014694 Rosetta Predictions human pricing
XM_001078833 Rosetta Predictions rat pricing
XM_231125 Rosetta Predictions rat pricing
NM_029981 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014694 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158624 predicted 980
2 SASI_Hs01_00158625 predicted 1083
3 SASI_Hs01_00158626 predicted 2744
4 SASI_Hs01_00158627 predicted 926
5 SASI_Hs01_00158628 predicted 1974
6 SASI_Hs01_00158630 predicted 1122
7 SASI_Hs01_00158631 predicted 1304
8 SASI_Hs02_00346080 predicted 1956
9 SASI_Hs02_00346081 predicted 2488
10 SASI_Hs01_00158633 predicted 1153
11 SASI_Hs01_00158629 predicted 301
12 SASI_Hs01_00158632 predicted 1145
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078833 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00362160 predicted 818
2 SASI_Rn02_00362161 predicted 2716
3 SASI_Rn02_00362162 predicted 709
4 SASI_Rn02_00362163 predicted 1498
5 SASI_Rn02_00362164 predicted 2285
6 SASI_Rn02_00362165 predicted 2549
7 SASI_Rn02_00362166 predicted 1427
8 SASI_Rn02_00362167 predicted 667
9 SASI_Rn02_00362168 predicted 645
10 SASI_Rn02_00362169 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_231125 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386674 predicted 819
2 SASI_Rn02_00386675 predicted 713
3 SASI_Rn02_00386676 predicted 1494
4 SASI_Rn02_00386677 predicted 2286
5 SASI_Rn02_00386678 predicted 680
6 SASI_Rn02_00386679 predicted 1549
7 SASI_Rn02_00386680 predicted 1422
8 SASI_Rn02_00386681 predicted 663
9 SASI_Rn02_00386682 predicted 646
10 SASI_Rn02_00386683 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029981 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147100 predicted 868
2 SASI_Mm01_00147101 predicted 958
3 SASI_Mm01_00147102 predicted 906
4 SASI_Mm01_00147103 predicted 1532
5 SASI_Mm01_00147104 predicted 2546
6 SASI_Mm01_00147105 predicted 838
7 SASI_Mm01_00147106 predicted 857
8 SASI_Mm01_00147107 predicted 2168
9 SASI_Mm01_00147108 predicted 1117
10 SASI_Mm01_00147109 predicted 542
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_130065
ADAMTSL2 MISSION shRNA Bacterial Glycerol Stock
ADAMTS-like 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000092578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_130065.5-3086s1c1
Sequence:CCGGCCTGAGATATAAGCACGCTATCTCGAGATAGCGTGCTTATATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130065.5-1977s1c1
Sequence:CCGGGCCATGTGTGTTCGCTATGATCTCGAGATCATAGCGAACACACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130065.5-2177s1c1
Sequence:CCGGTGGATTTGACAGCTCCGTGTACTCGAGTACACGGAGCTGTCAAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130065.5-972s1c1
Sequence:CCGGGCTGGTTTCTACTTCTTCAATCTCGAGATTGAAGAAGTAGAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_130065
ADAMTSL2 MISSION shRNA shRNA Plasmid DNA
ADAMTS-like 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000092578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_130065.5-3086s1c1
Sequence:CCGGCCTGAGATATAAGCACGCTATCTCGAGATAGCGTGCTTATATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130065.5-1977s1c1
Sequence:CCGGGCCATGTGTGTTCGCTATGATCTCGAGATCATAGCGAACACACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130065.5-2177s1c1
Sequence:CCGGTGGATTTGACAGCTCCGTGTACTCGAGTACACGGAGCTGTCAAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130065.5-972s1c1
Sequence:CCGGGCTGGTTTCTACTTCTTCAATCTCGAGATTGAAGAAGTAGAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_130065
ADAMTSL2 MISSION shRNA Lentiviral Transduction Particles
ADAMTS-like 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000092578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_130065.5-3086s1c1
Sequence:CCGGCCTGAGATATAAGCACGCTATCTCGAGATAGCGTGCTTATATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130065.5-1977s1c1
Sequence:CCGGGCCATGTGTGTTCGCTATGATCTCGAGATCATAGCGAACACACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130065.5-2177s1c1
Sequence:CCGGTGGATTTGACAGCTCCGTGTACTCGAGTACACGGAGCTGTCAAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130065.5-972s1c1
Sequence:CCGGGCTGGTTTCTACTTCTTCAATCTCGAGATTGAAGAAGTAGAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014694
ADAMTSL2 MISSION shRNA Bacterial Glycerol Stock
ADAMTS-like 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118522    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014694.2-3455s1c1
Sequence:CCGGGCCTTCTGAAGGAAACTTGCACTCGAGTGCAAGTTTCCTTCAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014694.2-930s1c1
Sequence:CCGGGCCCGAGACATCCAGATTGTACTCGAGTACAATCTGGATGTCTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014694.2-938s1c1
Sequence:CCGGCATCCAGATTGTAGAGAGGAACTCGAGTTCCTCTCTACAATCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014694.2-1692s1c1
Sequence:CCGGGAGAGCTTCTTCGTGGATTATCTCGAGATAATCCACGAAGAAGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014694.2-1142s1c1
Sequence:CCGGCCTGAATGTCATGGTGTGGAACTCGAGTTCCACACCATGACATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014694.3-642s21c1
Sequence:CCGGATCTCCAGCAAACCGTGTGACCTCGAGGTCACACGGTTTGCTGGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014694.3-883s21c1
Sequence:CCGGGGAATGCCCACCTTGGTTACTCTCGAGAGTAACCAAGGTGGGCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014694.3-987s21c1
Sequence:CCGGGACGAAGCTGGCTACTACTTCCTCGAGGAAGTAGTAGCCAGCTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014694
ADAMTSL2 MISSION shRNA shRNA Plasmid DNA
ADAMTS-like 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118522    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014694.2-3455s1c1
Sequence:CCGGGCCTTCTGAAGGAAACTTGCACTCGAGTGCAAGTTTCCTTCAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014694.2-930s1c1
Sequence:CCGGGCCCGAGACATCCAGATTGTACTCGAGTACAATCTGGATGTCTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014694.2-938s1c1
Sequence:CCGGCATCCAGATTGTAGAGAGGAACTCGAGTTCCTCTCTACAATCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014694.2-1692s1c1
Sequence:CCGGGAGAGCTTCTTCGTGGATTATCTCGAGATAATCCACGAAGAAGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014694.2-1142s1c1
Sequence:CCGGCCTGAATGTCATGGTGTGGAACTCGAGTTCCACACCATGACATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014694.3-642s21c1
Sequence:CCGGATCTCCAGCAAACCGTGTGACCTCGAGGTCACACGGTTTGCTGGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014694.3-883s21c1
Sequence:CCGGGGAATGCCCACCTTGGTTACTCTCGAGAGTAACCAAGGTGGGCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014694.3-987s21c1
Sequence:CCGGGACGAAGCTGGCTACTACTTCCTCGAGGAAGTAGTAGCCAGCTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014694
ADAMTSL2 MISSION shRNA Lentiviral Transduction Particles
ADAMTS-like 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118522    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014694.2-3455s1c1
Sequence:CCGGGCCTTCTGAAGGAAACTTGCACTCGAGTGCAAGTTTCCTTCAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014694.2-930s1c1
Sequence:CCGGGCCCGAGACATCCAGATTGTACTCGAGTACAATCTGGATGTCTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014694.2-938s1c1
Sequence:CCGGCATCCAGATTGTAGAGAGGAACTCGAGTTCCTCTCTACAATCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014694.2-1692s1c1
Sequence:CCGGGAGAGCTTCTTCGTGGATTATCTCGAGATAATCCACGAAGAAGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014694.2-1142s1c1
Sequence:CCGGCCTGAATGTCATGGTGTGGAACTCGAGTTCCACACCATGACATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014694.3-642s21c1
Sequence:CCGGATCTCCAGCAAACCGTGTGACCTCGAGGTCACACGGTTTGCTGGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014694.3-883s21c1
Sequence:CCGGGGAATGCCCACCTTGGTTACTCTCGAGAGTAACCAAGGTGGGCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014694.3-987s21c1
Sequence:CCGGGACGAAGCTGGCTACTACTTCCTCGAGGAAGTAGTAGCCAGCTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks