EMAIL THIS PAGE TO A FRIEND

ADAMTSL3

ADAMTS-like 3

143 Gene Product Result for
UniProtKB ID: P82987, A1A566, A1A567, Q9ULI7
Gene ID:
Mouse(269959) ADAMTS-like 3
Rat(308787) ADAMTS-like 3
Zebrafish(100534944) ADAMTS-like 3
chicken(415465) ADAMTS-like 3
dog(479060) ADAMTS-like 3
domestic cat(101095419) ADAMTS-like 3
cow(537483) ADAMTS-like 3
sheep(101107392) ADAMTS-like 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_032181 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_032181 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_032181 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_194370 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_194370 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_194370 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU082781 MISSION® esiRNA esiRNA human ADAMTSL3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207517 Rosetta Predictions human pricing
NM_001107533 Rosetta Predictions rat pricing
XM_194370 Rosetta Predictions mouse pricing
XM_984557 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207517 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028571 predicted 624
2 SASI_Hs01_00028572 predicted 4013
3 SASI_Hs01_00028573 predicted 4202
4 SASI_Hs02_00374142 predicted 5196
5 SASI_Hs02_00374143 predicted 1294
6 SASI_Hs01_00028575 predicted 4096
7 SASI_Hs02_00374144 predicted 5391
8 SASI_Hs01_00028578 predicted 658
9 SASI_Hs01_00028579 predicted 2815
10 SASI_Hs02_00374145 predicted 1771
11 SASI_Hs01_00028574 predicted 5267
12 SASI_Hs01_00028576 predicted 1628
13 SASI_Hs01_00028577 predicted 2227
14 SASI_Hs01_00028580 predicted 4513
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107533 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229765 predicted 1997
2 SASI_Rn02_00229766 predicted 1638
3 SASI_Rn02_00229767 predicted 1492
4 SASI_Rn02_00229768 predicted 2620
5 SASI_Rn02_00229769 predicted 1761
6 SASI_Rn02_00229770 predicted 1624
7 SASI_Rn02_00229771 predicted 1992
8 SASI_Rn02_00229772 predicted 2083
9 SASI_Rn02_00229773 predicted 2071
10 SASI_Rn02_00229774 predicted 3173
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_194370 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00219615 predicted 4288
2 SASI_Mm01_00219617 predicted 3904
3 SASI_Mm01_00219619 predicted 5692
4 SASI_Mm01_00219620 predicted 2772
5 SASI_Mm01_00219621 predicted 3328
6 SASI_Mm01_00219622 predicted 3972
7 SASI_Mm01_00219623 predicted 3462
8 SASI_Mm02_00425476 predicted 3345
9 SASI_Mm01_00219624 predicted 4679
10 SASI_Mm02_00425477 predicted 3842
11 SASI_Mm01_00219616 predicted 5689
12 SASI_Mm01_00219618 predicted 4659
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_984557 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00448473 predicted 1136
2 SASI_Mm02_00448474 predicted 726
3 SASI_Mm02_00448475 predicted 973
4 SASI_Mm02_00448476 predicted 3799
5 SASI_Mm02_00448477 predicted 5677
6 SASI_Mm02_00448478 predicted 1745
7 SASI_Mm02_00448479 predicted 2769
8 SASI_Mm02_00448480 predicted 3806
9 SASI_Mm02_00448481 predicted 4665
10 SASI_Mm02_00448482 predicted 4451
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_032181
ADAMTSL3 MISSION shRNA Bacterial Glycerol Stock
ADAMTS-like 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_032181.3-5611s1c1
Sequence:CCGGGCTGCCTCTTTCCTGTGATATCTCGAGATATCACAGGAAAGAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_032181.3-4392s1c1
Sequence:CCGGCCAGAGAGTAGAATCGTATTTCTCGAGAAATACGATTCTACTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_032181.3-1620s1c1
Sequence:CCGGCCCAAACCCAAGGTTATGCAACTCGAGTTGCATAACCTTGGGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_032181.3-633s1c1
Sequence:CCGGGCCTACAATGATGTCCAGTATCTCGAGATACTGGACATCATTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_032181.3-1018s1c1
Sequence:CCGGCCCACCTCTTTATTGAATCAACTCGAGTTGATTCAATAAAGAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_032181
ADAMTSL3 MISSION shRNA shRNA Plasmid DNA
ADAMTS-like 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_032181.3-5611s1c1
Sequence:CCGGGCTGCCTCTTTCCTGTGATATCTCGAGATATCACAGGAAAGAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_032181.3-4392s1c1
Sequence:CCGGCCAGAGAGTAGAATCGTATTTCTCGAGAAATACGATTCTACTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_032181.3-1620s1c1
Sequence:CCGGCCCAAACCCAAGGTTATGCAACTCGAGTTGCATAACCTTGGGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_032181.3-633s1c1
Sequence:CCGGGCCTACAATGATGTCCAGTATCTCGAGATACTGGACATCATTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_032181.3-1018s1c1
Sequence:CCGGCCCACCTCTTTATTGAATCAACTCGAGTTGATTCAATAAAGAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_032181
ADAMTSL3 MISSION shRNA Lentiviral Transduction Particles
ADAMTS-like 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_032181.3-5611s1c1
Sequence:CCGGGCTGCCTCTTTCCTGTGATATCTCGAGATATCACAGGAAAGAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_032181.3-4392s1c1
Sequence:CCGGCCAGAGAGTAGAATCGTATTTCTCGAGAAATACGATTCTACTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_032181.3-1620s1c1
Sequence:CCGGCCCAAACCCAAGGTTATGCAACTCGAGTTGCATAACCTTGGGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_032181.3-633s1c1
Sequence:CCGGGCCTACAATGATGTCCAGTATCTCGAGATACTGGACATCATTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_032181.3-1018s1c1
Sequence:CCGGCCCACCTCTTTATTGAATCAACTCGAGTTGATTCAATAAAGAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_194370
ADAMTSL3 MISSION shRNA Bacterial Glycerol Stock
ADAMTS-like 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194370.4-4688s1c1
Sequence:CCGGCGGACACAACTCACTACTGTACTCGAGTACAGTAGTGAGTTGTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194370.4-2802s1c1
Sequence:CCGGGCGCCAGATGTGGAATAACAACTCGAGTTGTTATTCCACATCTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194370.4-1190s1c1
Sequence:CCGGCCTTCTCAGAATGTGTGGAAACTCGAGTTTCCACACATTCTGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194370.4-3690s1c1
Sequence:CCGGGCCTAATGTAACTTGGTTGAACTCGAGTTCAACCAAGTTACATTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_194370.4-6052s1c1
Sequence:CCGGCCCAAATAAGTGGTCCTGTTTCTCGAGAAACAGGACCACTTATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_194370
ADAMTSL3 MISSION shRNA shRNA Plasmid DNA
ADAMTS-like 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194370.4-4688s1c1
Sequence:CCGGCGGACACAACTCACTACTGTACTCGAGTACAGTAGTGAGTTGTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194370.4-2802s1c1
Sequence:CCGGGCGCCAGATGTGGAATAACAACTCGAGTTGTTATTCCACATCTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194370.4-1190s1c1
Sequence:CCGGCCTTCTCAGAATGTGTGGAAACTCGAGTTTCCACACATTCTGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194370.4-3690s1c1
Sequence:CCGGGCCTAATGTAACTTGGTTGAACTCGAGTTCAACCAAGTTACATTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_194370.4-6052s1c1
Sequence:CCGGCCCAAATAAGTGGTCCTGTTTCTCGAGAAACAGGACCACTTATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_194370
ADAMTSL3 MISSION shRNA Lentiviral Transduction Particles
ADAMTS-like 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194370.4-4688s1c1
Sequence:CCGGCGGACACAACTCACTACTGTACTCGAGTACAGTAGTGAGTTGTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194370.4-2802s1c1
Sequence:CCGGGCGCCAGATGTGGAATAACAACTCGAGTTGTTATTCCACATCTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194370.4-1190s1c1
Sequence:CCGGCCTTCTCAGAATGTGTGGAAACTCGAGTTTCCACACATTCTGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194370.4-3690s1c1
Sequence:CCGGGCCTAATGTAACTTGGTTGAACTCGAGTTCAACCAAGTTACATTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_194370.4-6052s1c1
Sequence:CCGGCCCAAATAAGTGGTCCTGTTTCTCGAGAAACAGGACCACTTATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks