EMAIL THIS PAGE TO A FRIEND

ADAMTSL4-AS1

ADAMTSL4 antisense RNA 1

Synonyms: C1orf138
Gene ID:
40 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001025493 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001025493 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001025493 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025493 Rosetta Predictions human pricing
XR_039834 Rosetta Predictions human pricing
XR_039835 Rosetta Predictions human pricing
XR_039836 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025493 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049854 predicted 651
2 SASI_Hs01_00049855 predicted 1084
3 SASI_Hs01_00049856 predicted 804
4 SASI_Hs01_00049857 predicted 1193
5 SASI_Hs01_00049858 predicted 1461
6 SASI_Hs01_00049859 predicted 829
7 SASI_Hs01_00049860 predicted 1160
8 SASI_Hs01_00049861 predicted 841
9 SASI_Hs01_00049862 predicted 787
10 SASI_Hs01_00049863 predicted 1285
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039834 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00513512 predicted 647
2 SASI_Hs02_00513513 predicted 1078
3 SASI_Hs02_00513514 predicted 797
4 SASI_Hs02_00513515 predicted 831
5 SASI_Hs02_00513516 predicted 1156
6 SASI_Hs02_00513517 predicted 569
7 SASI_Hs02_00513518 predicted 338
8 SASI_Hs02_00513519 predicted 562
9 SASI_Hs02_00513520 predicted 747
10 SASI_Hs02_00513521 predicted 790
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039835 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00513522 predicted 643
2 SASI_Hs02_00513523 predicted 1078
3 SASI_Hs02_00513524 predicted 795
4 SASI_Hs02_00513525 predicted 831
5 SASI_Hs02_00513526 predicted 1159
6 SASI_Hs02_00513527 predicted 569
7 SASI_Hs02_00513528 predicted 347
8 SASI_Hs02_00513529 predicted 561
9 SASI_Hs02_00513530 predicted 749
10 SASI_Hs02_00513531 predicted 791
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039836 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00513532 predicted 342
2 SASI_Hs02_00513533 predicted 648
3 SASI_Hs02_00513534 predicted 1083
4 SASI_Hs02_00513535 predicted 788
5 SASI_Hs02_00513536 predicted 831
6 SASI_Hs02_00513537 predicted 204
7 SASI_Hs02_00513538 predicted 1155
8 SASI_Hs02_00513539 predicted 569
9 SASI_Hs02_00513540 predicted 565
10 SASI_Hs02_00513541 predicted 749
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025493
ADAMTSL4-AS1 MISSION shRNA Bacterial Glycerol Stock
ADAMTSL4 antisense RNA 1
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000180610    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025493.1-1286s1c1
Sequence:CCGGGCGGATGCTCACATTTCTCTTCTCGAGAAGAGAAATGTGAGCATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179882    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025493.1-1287s1c1
Sequence:CCGGCGGATGCTCACATTTCTCTTTCTCGAGAAAGAGAAATGTGAGCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025493
ADAMTSL4-AS1 MISSION shRNA shRNA Plasmid DNA
ADAMTSL4 antisense RNA 1
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000180610    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025493.1-1286s1c1
Sequence:CCGGGCGGATGCTCACATTTCTCTTCTCGAGAAGAGAAATGTGAGCATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179882    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025493.1-1287s1c1
Sequence:CCGGCGGATGCTCACATTTCTCTTTCTCGAGAAAGAGAAATGTGAGCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025493
ADAMTSL4-AS1 MISSION shRNA Lentiviral Transduction Particles
ADAMTSL4 antisense RNA 1
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000180610    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025493.1-1286s1c1
Sequence:CCGGGCGGATGCTCACATTTCTCTTCTCGAGAAGAGAAATGTGAGCATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179882    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025493.1-1287s1c1
Sequence:CCGGCGGATGCTCACATTTCTCTTTCTCGAGAAAGAGAAATGTGAGCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks