EMAIL THIS PAGE TO A FRIEND

ADAMTSL4

ADAMTS-like 4

66 Gene Product Result for
Synonyms: ECTOL2 TSRC1
UniProtKB ID: Q6UY14, Q5T5F7, Q6IPM6, Q8N643, Q9HBS6
Gene ID:
Human(54507) Summary: This gene is a member of ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs)-like gene family and encodes a protein with protein with seven thrombospondin type 1 repeats. The thrombospondin type 1 repeat domain is found in many proteins with diverse biological functions including cellular adhesion, angiogenesis, and patterning of the developing nervous system. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(229595) ADAMTS-like 4
Rat(310670) ADAMTS-like 4
sheep(101106381) ADAMTS-like 4
domestic cat(101089952) ADAMTS-like 4
Horse(100059096) ADAMTS-like 4
dog(483184) ADAMTS-like 4
cow(507654) ADAMTS-like 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144899 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144899 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144899 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019032 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019032 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019032 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019032 Rosetta Predictions human pricing
NM_025008 Rosetta Predictions human pricing
NM_001034012 Rosetta Predictions rat pricing
NM_144899 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019032 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016236 predicted 306
2 SASI_Hs02_00352591 predicted 698
3 SASI_Hs01_00016237 predicted 1422
4 SASI_Hs01_00016238 predicted 1516
5 SASI_Hs01_00016239 predicted 2089
6 SASI_Hs01_00016240 predicted 432
7 SASI_Hs01_00016241 predicted 436
8 SASI_Hs01_00016242 predicted 772
9 SASI_Hs01_00016244 predicted 1517
10 SASI_Hs02_00352592 predicted 646
11 SASI_Hs01_00016235 predicted 1412
12 SASI_Hs01_00016243 predicted 1444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025008 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055833 predicted 305
2 SASI_Hs02_00357667 predicted 691
3 SASI_Hs01_00055834 predicted 1424
4 SASI_Hs01_00055835 predicted 1516
5 SASI_Hs01_00055836 predicted 2091
6 SASI_Hs01_00055837 predicted 438
7 SASI_Hs01_00055838 predicted 441
8 SASI_Hs01_00055839 predicted 766
9 SASI_Hs01_00055841 predicted 1513
10 SASI_Hs02_00357668 predicted 642
11 SASI_Hs01_00055832 predicted 1419
12 SASI_Hs01_00055840 predicted 1445
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034012 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062755 predicted 3687
2 SASI_Rn02_00203892 predicted 2721
3 SASI_Rn01_00062756 predicted 2208
4 SASI_Rn01_00062758 predicted 3173
5 SASI_Rn01_00062759 predicted 2910
6 SASI_Rn01_00062760 predicted 3660
7 SASI_Rn01_00062761 predicted 3590
8 SASI_Rn01_00062762 predicted 3202
9 SASI_Rn01_00062763 predicted 1948
10 SASI_Rn01_00062764 predicted 1579
11 SASI_Rn01_00062757 predicted 1564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144899 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055796 predicted 3267
2 SASI_Mm02_00340358 predicted 2076
3 SASI_Mm01_00055798 predicted 2536
4 SASI_Mm02_00340359 predicted 801
5 SASI_Mm01_00055799 predicted 750
6 SASI_Mm01_00055800 predicted 3216
7 SASI_Mm01_00055801 predicted 1744
8 SASI_Mm01_00055803 predicted 2425
9 SASI_Mm01_00055804 predicted 1198
10 SASI_Mm01_00055805 predicted 1064
11 SASI_Mm01_00055797 predicted 1190
12 SASI_Mm01_00055802 predicted 2429
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144899
ADAMTSL4 MISSION shRNA Bacterial Glycerol Stock
ADAMTS-like 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144899.2-3583s1c1
Sequence:CCGGCGTCTCCACATCTTCTAAATTCTCGAGAATTTAGAAGATGTGGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144899.2-2430s1c1
Sequence:CCGGGTTCGGTGTGTTGGCAGTAATCTCGAGATTACTGCCAACACACCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144899.2-1290s1c1
Sequence:CCGGCGATTCTATGTCCGACACACTCTCGAGAGTGTGTCGGACATAGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144899.2-1751s1c1
Sequence:CCGGCGTCTATATGATCTTTCAAGACTCGAGTCTTGAAAGATCATATAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144899.2-2789s1c1
Sequence:CCGGCACACAACACAGAGACATTATCTCGAGATAATGTCTCTGTGTTGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144899
ADAMTSL4 MISSION shRNA shRNA Plasmid DNA
ADAMTS-like 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144899.2-3583s1c1
Sequence:CCGGCGTCTCCACATCTTCTAAATTCTCGAGAATTTAGAAGATGTGGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144899.2-2430s1c1
Sequence:CCGGGTTCGGTGTGTTGGCAGTAATCTCGAGATTACTGCCAACACACCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144899.2-1290s1c1
Sequence:CCGGCGATTCTATGTCCGACACACTCTCGAGAGTGTGTCGGACATAGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144899.2-1751s1c1
Sequence:CCGGCGTCTATATGATCTTTCAAGACTCGAGTCTTGAAAGATCATATAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144899.2-2789s1c1
Sequence:CCGGCACACAACACAGAGACATTATCTCGAGATAATGTCTCTGTGTTGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144899
ADAMTSL4 MISSION shRNA Lentiviral Transduction Particles
ADAMTS-like 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144899.2-3583s1c1
Sequence:CCGGCGTCTCCACATCTTCTAAATTCTCGAGAATTTAGAAGATGTGGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144899.2-2430s1c1
Sequence:CCGGGTTCGGTGTGTTGGCAGTAATCTCGAGATTACTGCCAACACACCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144899.2-1290s1c1
Sequence:CCGGCGATTCTATGTCCGACACACTCTCGAGAGTGTGTCGGACATAGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144899.2-1751s1c1
Sequence:CCGGCGTCTATATGATCTTTCAAGACTCGAGTCTTGAAAGATCATATAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144899.2-2789s1c1
Sequence:CCGGCACACAACACAGAGACATTATCTCGAGATAATGTCTCTGTGTTGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019032
VALIDATED
ADAMTSL4 MISSION shRNA Bacterial Glycerol Stock
ADAMTS-like 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019032.3-931s1c1
Sequence:CCGGCAGAACCTCTAAGCCCTGAAACTCGAGTTTCAGGGCTTAGAGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019032.3-3042s1c1
Sequence:CCGGCGTAGAGACATCATCTGTGTACTCGAGTACACAGATGATGTCTCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019032.3-1901s1c1
Sequence:CCGGCGGGACCGTCTTTCGATATAACTCGAGTTATATCGAAAGACGGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019032.3-3941s1c1
Sequence:CCGGCCCTTCTCATTTGCCTAGTATCTCGAGATACTAGGCAAATGAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019032.3-1986s1c1
Sequence:CCGGGTGGATGTCTATATGATCTTTCTCGAGAAAGATCATATAGACATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019032.4-3863s21c1
Sequence:CCGGTTGTGCCCTAAGCCTCATTTCCTCGAGGAAATGAGGCTTAGGGCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019032.4-694s21c1
Sequence:CCGGAGCCAGGAATGTTCGGTTATGCTCGAGCATAACCGAACATTCCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019032.4-3702s21c1
Sequence:CCGGGTGTGTGCTCAAACGTGTATCCTCGAGGATACACGTTTGAGCACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019032.4-3815s21c1
Sequence:CCGGTTGCTAATCTGAGCTACTTAGCTCGAGCTAAGTAGCTCAGATTAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019032
VALIDATED
ADAMTSL4 MISSION shRNA shRNA Plasmid DNA
ADAMTS-like 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019032.3-931s1c1
Sequence:CCGGCAGAACCTCTAAGCCCTGAAACTCGAGTTTCAGGGCTTAGAGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019032.3-3042s1c1
Sequence:CCGGCGTAGAGACATCATCTGTGTACTCGAGTACACAGATGATGTCTCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019032.3-1901s1c1
Sequence:CCGGCGGGACCGTCTTTCGATATAACTCGAGTTATATCGAAAGACGGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019032.3-3941s1c1
Sequence:CCGGCCCTTCTCATTTGCCTAGTATCTCGAGATACTAGGCAAATGAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019032.3-1986s1c1
Sequence:CCGGGTGGATGTCTATATGATCTTTCTCGAGAAAGATCATATAGACATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019032.4-3863s21c1
Sequence:CCGGTTGTGCCCTAAGCCTCATTTCCTCGAGGAAATGAGGCTTAGGGCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019032.4-694s21c1
Sequence:CCGGAGCCAGGAATGTTCGGTTATGCTCGAGCATAACCGAACATTCCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019032.4-3702s21c1
Sequence:CCGGGTGTGTGCTCAAACGTGTATCCTCGAGGATACACGTTTGAGCACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019032.4-3815s21c1
Sequence:CCGGTTGCTAATCTGAGCTACTTAGCTCGAGCTAAGTAGCTCAGATTAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019032
VALIDATED
ADAMTSL4 MISSION shRNA Lentiviral Transduction Particles
ADAMTS-like 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019032.3-931s1c1
Sequence:CCGGCAGAACCTCTAAGCCCTGAAACTCGAGTTTCAGGGCTTAGAGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019032.3-3042s1c1
Sequence:CCGGCGTAGAGACATCATCTGTGTACTCGAGTACACAGATGATGTCTCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019032.3-1901s1c1
Sequence:CCGGCGGGACCGTCTTTCGATATAACTCGAGTTATATCGAAAGACGGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019032.3-3941s1c1
Sequence:CCGGCCCTTCTCATTTGCCTAGTATCTCGAGATACTAGGCAAATGAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019032.3-1986s1c1
Sequence:CCGGGTGGATGTCTATATGATCTTTCTCGAGAAAGATCATATAGACATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019032.4-3863s21c1
Sequence:CCGGTTGTGCCCTAAGCCTCATTTCCTCGAGGAAATGAGGCTTAGGGCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019032.4-694s21c1
Sequence:CCGGAGCCAGGAATGTTCGGTTATGCTCGAGCATAACCGAACATTCCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019032.4-3702s21c1
Sequence:CCGGGTGTGTGCTCAAACGTGTATCCTCGAGGATACACGTTTGAGCACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019032.4-3815s21c1
Sequence:CCGGTTGCTAATCTGAGCTACTTAGCTCGAGCTAAGTAGCTCAGATTAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks