EMAIL THIS PAGE TO A FRIEND

ADAMTSL5

ADAMTS-like 5

Synonyms: THSD6
UniProtKB ID: Q6ZMM2, Q8IW95
Gene ID:
Mouse(66548) ADAMTS-like 5
Rat(314626) ADAMTS-like 5
chicken(427264) ADAMTS-like 5
cow(100337439) ADAMTS-like 5
cow(616145) ADAMTS-like 5
domestic cat(101098200) ADAMTS-like 5
dog(485082) ADAMTS-like 5
sheep(101119210) ADAMTS-like 5
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB3500142 Anti-ADAMTSL5 antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA044050 Anti-ADAMTSL5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_294919 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_294919 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_294919 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025629 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025629 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025629 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_213604 Rosetta Predictions human pricing
NM_001108071 Rosetta Predictions rat pricing
NM_001113548 Rosetta Predictions mouse pricing
NM_025629 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213604 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239592 predicted 559
2 SASI_Hs01_00239593 predicted 1107
3 SASI_Hs01_00239594 predicted 1361
4 SASI_Hs01_00239595 predicted 978
5 SASI_Hs02_00374283 predicted 1363
6 SASI_Hs01_00239596 predicted 944
7 SASI_Hs01_00239597 predicted 1004
8 SASI_Hs01_00239598 predicted 601
9 SASI_Hs01_00239600 predicted 1361
10 SASI_Hs01_00239601 predicted 1434
11 SASI_Hs01_00239599 predicted 1048
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108071 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235064 predicted 309
2 SASI_Rn02_00235065 predicted 644
3 SASI_Rn02_00235066 predicted 528
4 SASI_Rn02_00235067 predicted 630
5 SASI_Rn02_00235068 predicted 797
6 SASI_Rn02_00235069 predicted 616
7 SASI_Rn02_00235070 predicted 232
8 SASI_Rn02_00235071 predicted 384
9 SASI_Rn02_00235072 predicted 581
10 SASI_Rn02_00235073 predicted 216
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113548 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308123 predicted 814
2 SASI_Mm02_00308124 predicted 910
3 SASI_Mm02_00308125 predicted 890
4 SASI_Mm02_00308126 predicted 817
5 SASI_Mm02_00308127 predicted 814
6 SASI_Mm02_00308128 predicted 819
7 SASI_Mm02_00308129 predicted 785
8 SASI_Mm02_00308130 predicted 796
9 SASI_Mm02_00308131 predicted 892
10 SASI_Mm02_00308132 predicted 919
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025629 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328683 predicted 498
2 SASI_Mm01_00075152 predicted 591
3 SASI_Mm02_00328684 predicted 571
4 SASI_Mm01_00075154 predicted 493
5 SASI_Mm02_00328685 predicted 488
6 SASI_Mm02_00328686 predicted 497
7 SASI_Mm02_00328687 predicted 467
8 SASI_Mm02_00328688 predicted 473
9 SASI_Mm01_00075155 predicted 575
10 SASI_Mm01_00075156 predicted 600
11 SASI_Mm01_00075151 predicted 222
12 SASI_Mm01_00075153 predicted 284
13 SASI_Mm01_00075157 predicted 289
14 SASI_Mm01_00075158 predicted 767
15 SASI_Mm01_00075159 predicted 550
16 SASI_Mm01_00075160 predicted 598
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_294919
ADAMTSL5 MISSION shRNA Bacterial Glycerol Stock
ADAMTS-like 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294919.2-1887s1c1
Sequence:CCGGGCCCACCGACTACTCCACTATCTCGAGATAGTGGAGTAGTCGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294919.2-1888s1c1
Sequence:CCGGCCCACCGACTACTCCACTATTCTCGAGAATAGTGGAGTAGTCGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294919.2-1208s1c1
Sequence:CCGGGCACGCCTTCTACCACAGCTTCTCGAGAAGCTGTGGTAGAAGGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294919.2-1455s1c1
Sequence:CCGGGCCAGACACATCCGCGTGGAACTCGAGTTCCACGCGGATGTGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294919.2-1682s1c1
Sequence:CCGGCCCTGGCATCGAGTTTGAGTTCTCGAGAACTCAAACTCGATGCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_294919
ADAMTSL5 MISSION shRNA shRNA Plasmid DNA
ADAMTS-like 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294919.2-1887s1c1
Sequence:CCGGGCCCACCGACTACTCCACTATCTCGAGATAGTGGAGTAGTCGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294919.2-1888s1c1
Sequence:CCGGCCCACCGACTACTCCACTATTCTCGAGAATAGTGGAGTAGTCGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294919.2-1208s1c1
Sequence:CCGGGCACGCCTTCTACCACAGCTTCTCGAGAAGCTGTGGTAGAAGGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294919.2-1455s1c1
Sequence:CCGGGCCAGACACATCCGCGTGGAACTCGAGTTCCACGCGGATGTGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294919.2-1682s1c1
Sequence:CCGGCCCTGGCATCGAGTTTGAGTTCTCGAGAACTCAAACTCGATGCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_294919
ADAMTSL5 MISSION shRNA Lentiviral Transduction Particles
ADAMTS-like 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294919.2-1887s1c1
Sequence:CCGGGCCCACCGACTACTCCACTATCTCGAGATAGTGGAGTAGTCGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294919.2-1888s1c1
Sequence:CCGGCCCACCGACTACTCCACTATTCTCGAGAATAGTGGAGTAGTCGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294919.2-1208s1c1
Sequence:CCGGGCACGCCTTCTACCACAGCTTCTCGAGAAGCTGTGGTAGAAGGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294919.2-1455s1c1
Sequence:CCGGGCCAGACACATCCGCGTGGAACTCGAGTTCCACGCGGATGTGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294919.2-1682s1c1
Sequence:CCGGCCCTGGCATCGAGTTTGAGTTCTCGAGAACTCAAACTCGATGCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025629
VALIDATED
ADAMTSL5 MISSION shRNA Bacterial Glycerol Stock
ADAMTS-like 5
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025629.1-774s1c1
Sequence:CCGGCGCTAACGACTCTTGCCTGTTCTCGAGAACAGGCAAGAGTCGTTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025629.1-589s1c1
Sequence:CCGGGTGTGTGACCTCAACTGCCTACTCGAGTAGGCAGTTGAGGTCACACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025629.1-282s1c1
Sequence:CCGGGACTCTCCTGAGCTGTGATTTCTCGAGAAATCACAGCTCAGGAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025629.1-504s1c1
Sequence:CCGGCCTGCAGTGTTCTCTCTACAACTCGAGTTGTAGAGAGAACACTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025629.2-873s21c1
Sequence:CCGGGGTGTCCCTTTAACAAGTTTGCTCGAGCAAACTTGTTAAAGGGACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025629.2-439s21c1
Sequence:CCGGACAGCCATGAATACCGGGTGTCTCGAGACACCCGGTATTCATGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025629.2-493s21c1
Sequence:CCGGCATTCCGAGACCTGCAGTGTTCTCGAGAACACTGCAGGTCTCGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025629.2-281s21c1
Sequence:CCGGGACTCTCCTGAGCTGTGATTTCTCGAGAAATCACAGCTCAGGAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025629.2-410s21c1
Sequence:CCGGACTTCCCGGAGAGGAACTTTGCTCGAGCAAAGTTCCTCTCCGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025629.2-226s21c1
Sequence:CCGGTAACCCTGTGCTCCCTCAAACCTCGAGGTTTGAGGGAGCACAGGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025629.2-384s21c1
Sequence:CCGGTCAGTGCGCAGACGCCAATGTCTCGAGACATTGGCGTCTGCGCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025629.2-259s21c1
Sequence:CCGGCGCTTCTTCCGTTCTTGCTGTCTCGAGACAGCAAGAACGGAAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025629
VALIDATED
ADAMTSL5 MISSION shRNA shRNA Plasmid DNA
ADAMTS-like 5
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025629.1-774s1c1
Sequence:CCGGCGCTAACGACTCTTGCCTGTTCTCGAGAACAGGCAAGAGTCGTTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025629.1-589s1c1
Sequence:CCGGGTGTGTGACCTCAACTGCCTACTCGAGTAGGCAGTTGAGGTCACACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025629.1-282s1c1
Sequence:CCGGGACTCTCCTGAGCTGTGATTTCTCGAGAAATCACAGCTCAGGAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025629.1-504s1c1
Sequence:CCGGCCTGCAGTGTTCTCTCTACAACTCGAGTTGTAGAGAGAACACTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025629.2-873s21c1
Sequence:CCGGGGTGTCCCTTTAACAAGTTTGCTCGAGCAAACTTGTTAAAGGGACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025629.2-439s21c1
Sequence:CCGGACAGCCATGAATACCGGGTGTCTCGAGACACCCGGTATTCATGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025629.2-493s21c1
Sequence:CCGGCATTCCGAGACCTGCAGTGTTCTCGAGAACACTGCAGGTCTCGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025629.2-281s21c1
Sequence:CCGGGACTCTCCTGAGCTGTGATTTCTCGAGAAATCACAGCTCAGGAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025629.2-410s21c1
Sequence:CCGGACTTCCCGGAGAGGAACTTTGCTCGAGCAAAGTTCCTCTCCGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025629.2-226s21c1
Sequence:CCGGTAACCCTGTGCTCCCTCAAACCTCGAGGTTTGAGGGAGCACAGGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025629.2-384s21c1
Sequence:CCGGTCAGTGCGCAGACGCCAATGTCTCGAGACATTGGCGTCTGCGCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025629.2-259s21c1
Sequence:CCGGCGCTTCTTCCGTTCTTGCTGTCTCGAGACAGCAAGAACGGAAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025629
VALIDATED
ADAMTSL5 MISSION shRNA Lentiviral Transduction Particles
ADAMTS-like 5
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025629.1-774s1c1
Sequence:CCGGCGCTAACGACTCTTGCCTGTTCTCGAGAACAGGCAAGAGTCGTTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025629.1-589s1c1
Sequence:CCGGGTGTGTGACCTCAACTGCCTACTCGAGTAGGCAGTTGAGGTCACACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025629.1-282s1c1
Sequence:CCGGGACTCTCCTGAGCTGTGATTTCTCGAGAAATCACAGCTCAGGAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025629.1-504s1c1
Sequence:CCGGCCTGCAGTGTTCTCTCTACAACTCGAGTTGTAGAGAGAACACTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025629.2-873s21c1
Sequence:CCGGGGTGTCCCTTTAACAAGTTTGCTCGAGCAAACTTGTTAAAGGGACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025629.2-439s21c1
Sequence:CCGGACAGCCATGAATACCGGGTGTCTCGAGACACCCGGTATTCATGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025629.2-493s21c1
Sequence:CCGGCATTCCGAGACCTGCAGTGTTCTCGAGAACACTGCAGGTCTCGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025629.2-281s21c1
Sequence:CCGGGACTCTCCTGAGCTGTGATTTCTCGAGAAATCACAGCTCAGGAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025629.2-410s21c1
Sequence:CCGGACTTCCCGGAGAGGAACTTTGCTCGAGCAAAGTTCCTCTCCGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025629.2-226s21c1
Sequence:CCGGTAACCCTGTGCTCCCTCAAACCTCGAGGTTTGAGGGAGCACAGGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025629.2-384s21c1
Sequence:CCGGTCAGTGCGCAGACGCCAATGTCTCGAGACATTGGCGTCTGCGCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025629.2-259s21c1
Sequence:CCGGCGCTTCTTCCGTTCTTGCTGTCTCGAGACAGCAAGAACGGAAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks