EMAIL THIS PAGE TO A FRIEND

ADAP2

ArfGAP with dual PH domains 2

116 Gene Product Result for
Synonyms: CENTA2 HSA272195 cent-b
UniProtKB ID: Q9NPF8, Q8N4Q6, Q96SD5
Gene ID:
Mouse(216991) ArfGAP with dual PH domains 2
Rat(56826) ArfGAP with dual PH domains 2
domestic guinea pig(100719135) ArfGAP with dual PH domains 2
naked mole-rat(101720668) ArfGAP with dual PH domains 2
sheep(101121946) ArfGAP with dual PH domains 2
chicken(417409) ArfGAP with dual PH domains 2
domestic cat(101093903) ArfGAP with dual PH domains 2
cow(534106) ArfGAP with dual PH domains 2
Horse(100058484) ArfGAP with dual PH domains 2
dog(610782) ArfGAP with dual PH domains 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018404 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018404 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018404 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172133 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172133 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172133 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018404 Rosetta Predictions human pricing
NM_020101 Rosetta Predictions rat pricing
NM_172133 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018404 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187087 predicted 528
2 SASI_Hs01_00187089 predicted 1047
3 SASI_Hs02_00351902 predicted 1380
4 SASI_Hs01_00187091 predicted 440
5 SASI_Hs01_00187092 predicted 1196
6 SASI_Hs01_00187093 predicted 468
7 SASI_Hs02_00351903 predicted 600
8 SASI_Hs01_00187095 predicted 453
9 SASI_Hs01_00187096 predicted 494
10 SASI_Hs02_00351904 predicted 1137
11 SASI_Hs01_00187088 predicted 485
12 SASI_Hs01_00187090 predicted 932
13 SASI_Hs01_00187094 predicted 629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020101 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106801 predicted 396
2 SASI_Rn02_00262510 predicted 310
3 SASI_Rn01_00106803 predicted 958
4 SASI_Rn01_00106804 predicted 1035
5 SASI_Rn01_00106805 predicted 691
6 SASI_Rn01_00106806 predicted 970
7 SASI_Rn01_00106807 predicted 577
8 SASI_Rn01_00106808 predicted 957
9 SASI_Rn01_00106809 predicted 253
10 SASI_Rn01_00106810 predicted 1161
11 SASI_Rn01_00106802 predicted 302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172133 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099263 predicted 977
2 SASI_Mm01_00099264 predicted 966
3 SASI_Mm01_00099265 predicted 439
4 SASI_Mm01_00099266 predicted 260
5 SASI_Mm01_00099267 predicted 708
6 SASI_Mm01_00099268 predicted 384
7 SASI_Mm01_00099269 predicted 219
8 SASI_Mm01_00099270 predicted 1217
9 SASI_Mm01_00099271 predicted 413
10 SASI_Mm01_00099272 predicted 391
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018404
VALIDATED
ADAP2 MISSION shRNA Bacterial Glycerol Stock
ArfGAP with dual PH domains 2
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018404.1-431s1c1
Sequence:CCGGCAATGGATTCGAGCTAAGTATCTCGAGATACTTAGCTCGAATCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018404.1-595s1c1
Sequence:CCGGCTTCACAAAGGAACAGGGTAACTCGAGTTACCCTGTTCCTTTGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018404.1-308s1c1
Sequence:CCGGGACGACAGTATTGTGGAGTTTCTCGAGAAACTCCACAATACTGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139232    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018404.1-1899s1c1
Sequence:CCGGCCACGCAGAAATACACTGGATCTCGAGATCCAGTGTATTTCTGCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018404.1-1570s1c1
Sequence:CCGGGCATCATGCAAGTGGCATCTTCTCGAGAAGATGCCACTTGCATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141030    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018404.1-1529s1c1
Sequence:CCGGCACATCTGAAATGGAGGCATTCTCGAGAATGCCTCCATTTCAGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141491    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018404.1-1902s1c1
Sequence:CCGGCGCAGAAATACACTGGATGTTCTCGAGAACATCCAGTGTATTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018404.1-955s1c1
Sequence:CCGGGAGGCTGCTCTATTACAAGAACTCGAGTTCTTGTAATAGAGCAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018404.1-898s1c1
Sequence:CCGGGCCAAAGCAGAAAGAACCTTTCTCGAGAAAGGTTCTTTCTGCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018404.1-414s1c1
Sequence:CCGGGCCTGGTCTTAAAGGAACAATCTCGAGATTGTTCCTTTAAGACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018404.2-593s21c1
Sequence:CCGGGCCTGGTCTTAAAGGAACAATCTCGAGATTGTTCCTTTAAGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018404.2-610s21c1
Sequence:CCGGCAATGGATTCGAGCTAAGTATCTCGAGATACTTAGCTCGAATCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292162    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018404.2-1883s21c1
Sequence:CCGGTGAAAGATAAAGTAGTCAATGCTCGAGCATTGACTACTTTATCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018404.2-1134s21c1
Sequence:CCGGGAGGCTGCTCTATTACAAGAACTCGAGTTCTTGTAATAGAGCAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018404.2-1077s21c1
Sequence:CCGGGCCAAAGCAGAAAGAACCTTTCTCGAGAAAGGTTCTTTCTGCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018404
VALIDATED
ADAP2 MISSION shRNA shRNA Plasmid DNA
ArfGAP with dual PH domains 2
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018404.1-431s1c1
Sequence:CCGGCAATGGATTCGAGCTAAGTATCTCGAGATACTTAGCTCGAATCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018404.1-595s1c1
Sequence:CCGGCTTCACAAAGGAACAGGGTAACTCGAGTTACCCTGTTCCTTTGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018404.1-308s1c1
Sequence:CCGGGACGACAGTATTGTGGAGTTTCTCGAGAAACTCCACAATACTGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139232    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018404.1-1899s1c1
Sequence:CCGGCCACGCAGAAATACACTGGATCTCGAGATCCAGTGTATTTCTGCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018404.1-1570s1c1
Sequence:CCGGGCATCATGCAAGTGGCATCTTCTCGAGAAGATGCCACTTGCATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141030    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018404.1-1529s1c1
Sequence:CCGGCACATCTGAAATGGAGGCATTCTCGAGAATGCCTCCATTTCAGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141491    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018404.1-1902s1c1
Sequence:CCGGCGCAGAAATACACTGGATGTTCTCGAGAACATCCAGTGTATTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018404.1-955s1c1
Sequence:CCGGGAGGCTGCTCTATTACAAGAACTCGAGTTCTTGTAATAGAGCAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018404.1-898s1c1
Sequence:CCGGGCCAAAGCAGAAAGAACCTTTCTCGAGAAAGGTTCTTTCTGCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018404.1-414s1c1
Sequence:CCGGGCCTGGTCTTAAAGGAACAATCTCGAGATTGTTCCTTTAAGACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018404.2-593s21c1
Sequence:CCGGGCCTGGTCTTAAAGGAACAATCTCGAGATTGTTCCTTTAAGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018404.2-610s21c1
Sequence:CCGGCAATGGATTCGAGCTAAGTATCTCGAGATACTTAGCTCGAATCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292162    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018404.2-1883s21c1
Sequence:CCGGTGAAAGATAAAGTAGTCAATGCTCGAGCATTGACTACTTTATCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018404.2-1134s21c1
Sequence:CCGGGAGGCTGCTCTATTACAAGAACTCGAGTTCTTGTAATAGAGCAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018404.2-1077s21c1
Sequence:CCGGGCCAAAGCAGAAAGAACCTTTCTCGAGAAAGGTTCTTTCTGCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018404
VALIDATED
ADAP2 MISSION shRNA Lentiviral Transduction Particles
ArfGAP with dual PH domains 2
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018404.1-431s1c1
Sequence:CCGGCAATGGATTCGAGCTAAGTATCTCGAGATACTTAGCTCGAATCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018404.1-595s1c1
Sequence:CCGGCTTCACAAAGGAACAGGGTAACTCGAGTTACCCTGTTCCTTTGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018404.1-308s1c1
Sequence:CCGGGACGACAGTATTGTGGAGTTTCTCGAGAAACTCCACAATACTGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139232    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018404.1-1899s1c1
Sequence:CCGGCCACGCAGAAATACACTGGATCTCGAGATCCAGTGTATTTCTGCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018404.1-1570s1c1
Sequence:CCGGGCATCATGCAAGTGGCATCTTCTCGAGAAGATGCCACTTGCATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141030    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018404.1-1529s1c1
Sequence:CCGGCACATCTGAAATGGAGGCATTCTCGAGAATGCCTCCATTTCAGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141491    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018404.1-1902s1c1
Sequence:CCGGCGCAGAAATACACTGGATGTTCTCGAGAACATCCAGTGTATTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018404.1-955s1c1
Sequence:CCGGGAGGCTGCTCTATTACAAGAACTCGAGTTCTTGTAATAGAGCAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018404.1-898s1c1
Sequence:CCGGGCCAAAGCAGAAAGAACCTTTCTCGAGAAAGGTTCTTTCTGCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018404.1-414s1c1
Sequence:CCGGGCCTGGTCTTAAAGGAACAATCTCGAGATTGTTCCTTTAAGACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018404.2-593s21c1
Sequence:CCGGGCCTGGTCTTAAAGGAACAATCTCGAGATTGTTCCTTTAAGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018404.2-610s21c1
Sequence:CCGGCAATGGATTCGAGCTAAGTATCTCGAGATACTTAGCTCGAATCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292162    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018404.2-1883s21c1
Sequence:CCGGTGAAAGATAAAGTAGTCAATGCTCGAGCATTGACTACTTTATCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018404.2-1134s21c1
Sequence:CCGGGAGGCTGCTCTATTACAAGAACTCGAGTTCTTGTAATAGAGCAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018404.2-1077s21c1
Sequence:CCGGGCCAAAGCAGAAAGAACCTTTCTCGAGAAAGGTTCTTTCTGCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172133
VALIDATED
ADAP2 MISSION shRNA Bacterial Glycerol Stock
ArfGAP with dual PH domains 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106215    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172133.1-1413s1c1
Sequence:CCGGGCTTAGAAGTCCTGAAGGGTTCTCGAGAACCCTTCAGGACTTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172133.1-300s1c1
Sequence:CCGGCCTCAACGTGAAAGCCAAGTTCTCGAGAACTTGGCTTTCACGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172133.1-220s1c1
Sequence:CCGGCCAGACATCAGCAAAGTTAAACTCGAGTTTAACTTTGCTGATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172133.1-747s1c1
Sequence:CCGGCCGCCTGCAATACCTGAAATTCTCGAGAATTTCAGGTATTGCAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172133.1-368s1c1
Sequence:CCGGGCCTGGTCTTAAAGGAACAATCTCGAGATTGTTCCTTTAAGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172133.1-300s21c1
Sequence:CCGGCCTCAACGTGAAAGCCAAGTTCTCGAGAACTTGGCTTTCACGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172133.1-368s21c1
Sequence:CCGGGCCTGGTCTTAAAGGAACAATCTCGAGATTGTTCCTTTAAGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172133.1-220s21c1
Sequence:CCGGCCAGACATCAGCAAAGTTAAACTCGAGTTTAACTTTGCTGATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172133.1-904s21c1
Sequence:CCGGGAACGGAGGCTGCTCTATTATCTCGAGATAATAGAGCAGCCTCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172133.1-1253s21c1
Sequence:CCGGGTTCACCTCAGCCCTAGTTGTCTCGAGACAACTAGGGCTGAGGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172133
VALIDATED
ADAP2 MISSION shRNA shRNA Plasmid DNA
ArfGAP with dual PH domains 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106215    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172133.1-1413s1c1
Sequence:CCGGGCTTAGAAGTCCTGAAGGGTTCTCGAGAACCCTTCAGGACTTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172133.1-300s1c1
Sequence:CCGGCCTCAACGTGAAAGCCAAGTTCTCGAGAACTTGGCTTTCACGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172133.1-220s1c1
Sequence:CCGGCCAGACATCAGCAAAGTTAAACTCGAGTTTAACTTTGCTGATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172133.1-747s1c1
Sequence:CCGGCCGCCTGCAATACCTGAAATTCTCGAGAATTTCAGGTATTGCAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172133.1-368s1c1
Sequence:CCGGGCCTGGTCTTAAAGGAACAATCTCGAGATTGTTCCTTTAAGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172133.1-300s21c1
Sequence:CCGGCCTCAACGTGAAAGCCAAGTTCTCGAGAACTTGGCTTTCACGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172133.1-368s21c1
Sequence:CCGGGCCTGGTCTTAAAGGAACAATCTCGAGATTGTTCCTTTAAGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172133.1-220s21c1
Sequence:CCGGCCAGACATCAGCAAAGTTAAACTCGAGTTTAACTTTGCTGATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172133.1-904s21c1
Sequence:CCGGGAACGGAGGCTGCTCTATTATCTCGAGATAATAGAGCAGCCTCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172133.1-1253s21c1
Sequence:CCGGGTTCACCTCAGCCCTAGTTGTCTCGAGACAACTAGGGCTGAGGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172133
VALIDATED
ADAP2 MISSION shRNA Lentiviral Transduction Particles
ArfGAP with dual PH domains 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106215    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172133.1-1413s1c1
Sequence:CCGGGCTTAGAAGTCCTGAAGGGTTCTCGAGAACCCTTCAGGACTTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172133.1-300s1c1
Sequence:CCGGCCTCAACGTGAAAGCCAAGTTCTCGAGAACTTGGCTTTCACGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172133.1-220s1c1
Sequence:CCGGCCAGACATCAGCAAAGTTAAACTCGAGTTTAACTTTGCTGATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172133.1-747s1c1
Sequence:CCGGCCGCCTGCAATACCTGAAATTCTCGAGAATTTCAGGTATTGCAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172133.1-368s1c1
Sequence:CCGGGCCTGGTCTTAAAGGAACAATCTCGAGATTGTTCCTTTAAGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172133.1-300s21c1
Sequence:CCGGCCTCAACGTGAAAGCCAAGTTCTCGAGAACTTGGCTTTCACGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172133.1-368s21c1
Sequence:CCGGGCCTGGTCTTAAAGGAACAATCTCGAGATTGTTCCTTTAAGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172133.1-220s21c1
Sequence:CCGGCCAGACATCAGCAAAGTTAAACTCGAGTTTAACTTTGCTGATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172133.1-904s21c1
Sequence:CCGGGAACGGAGGCTGCTCTATTATCTCGAGATAATAGAGCAGCCTCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172133.1-1253s21c1
Sequence:CCGGGTTCACCTCAGCCCTAGTTGTCTCGAGACAACTAGGGCTGAGGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks