EMAIL THIS PAGE TO A FRIEND

ADAR

adenosine deaminase, RNA-specific

168 Gene Product Result for
Synonyms: ADAR1 AGS6 DRADA DSH DSRAD G1P1 IFI-4 IFI4 K88DSRBP P136
Gene ID:
Human(103) Summary: This gene encodes the enzyme responsible for RNA editing by site-specific deamination of adenosines. This enzyme destabilizes double-stranded RNA through conversion of adenosine to inosine. Mutations in this gene have been associated with dyschromatosis symmetrica hereditaria. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010]
Mouse(56417) adenosine deaminase, RNA-specific
Rat(81635) adenosine deaminase, RNA-specific
Zebrafish(58119) adenosine deaminase, RNA-specific
fruit fly(31130) Adenosine deaminase acting on RNA
cow(505134) adenosine deaminase, RNA-specific
Horse(100056984) adenosine deaminase, RNA-specific
domestic cat(101084681) adenosine deaminase, RNA-specific
dog(490442) adenosine deaminase, RNA-specific
chicken(769675) adenosine deaminase, RNA-specific
sheep(101104366) adenosine deaminase, RNA-specific
Domestic Rabbit(100346984) adenosine deaminase, RNA-specific
naked mole-rat(101722209) adenosine deaminase, RNA-specific
domestic guinea pig(100731315) adenosine deaminase, RNA-specific
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1405425 Anti-ADAR antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA003890 Anti-ADAR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA051519 Anti-ADAR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB1401004 Anti-ADAR antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB4200542 Anti-ADAR1 (C-terminal) antibody produced in rabbit IgG fraction of antiserum human
immunoprecipitation, western blot pricing
SAB4200541 Anti-ADAR1 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human
immunofluorescence, immunoprecipitation, western blot pricing
SAB4500077 Anti-ADAR1, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry pricing
AMAB90535 Monoclonal Anti-ADAR antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0176, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4200482 Monoclonal Anti-ADAR1 antibody produced in mouse ~1.0 mg/mL, clone ADAR61, purified immunoglobulin monkey, rat, human
flow cytometry, immunoprecipitation, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001111 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001111 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001111 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019655 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019655 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019655 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025107 Rosetta Predictions human pricing
NM_001111 Rosetta Predictions human pricing
NM_015840 Rosetta Predictions human pricing
NM_015841 Rosetta Predictions human pricing
NM_031006 Rosetta Predictions rat pricing
NM_001038587 Rosetta Predictions mouse pricing
NM_019655 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025107 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115047 predicted 996
2 SASI_Hs01_00115048 predicted 1768
3 SASI_Hs01_00115049 predicted 3325
4 SASI_Hs02_00307372 predicted 3616
5 SASI_Hs01_00115051 predicted 1172
6 SASI_Hs01_00115052 predicted 1056
7 SASI_Hs01_00115053 predicted 1194
8 SASI_Hs01_00115054 predicted 3482
9 SASI_Hs01_00115055 predicted 3541
10 SASI_Hs02_00307373 predicted 3308
11 SASI_Hs01_00115046 predicted 2953
12 SASI_Hs01_00115050 predicted 1698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244017 predicted 1109
2 SASI_Hs01_00244018 predicted 3432
3 SASI_Hs01_00244019 predicted 1793
4 SASI_Hs02_00325065 predicted 1952
5 SASI_Hs01_00244021 predicted 1287
6 SASI_Hs01_00244022 predicted 3562
7 SASI_Hs01_00244023 predicted 424
8 SASI_Hs01_00244024 predicted 623
9 SASI_Hs01_00244025 predicted 412
10 SASI_Hs01_00244026 predicted 732
11 SASI_Hs01_00244020 predicted 1371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015840 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110500 predicted 1108
2 SASI_Hs01_00110501 predicted 3352
3 SASI_Hs01_00110502 predicted 1794
4 SASI_Hs01_00110504 predicted 1950
5 SASI_Hs01_00110505 predicted 1280
6 SASI_Hs01_00110506 predicted 3486
7 SASI_Hs02_00348428 predicted 424
8 SASI_Hs01_00110508 predicted 624
9 SASI_Hs02_00348429 predicted 416
10 SASI_Hs01_00110509 predicted 737
11 SASI_Hs01_00110503 predicted 1370
12 SASI_Hs01_00110507 predicted 2931
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015841 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063313 predicted 1104
2 SASI_Hs01_00063314 predicted 3296
3 SASI_Hs01_00063315 predicted 1792
4 SASI_Hs01_00063317 predicted 1950
5 SASI_Hs01_00063318 predicted 1287
6 SASI_Hs01_00063319 predicted 3428
7 SASI_Hs02_00348430 predicted 421
8 SASI_Hs01_00063321 predicted 619
9 SASI_Hs02_00348431 predicted 409
10 SASI_Hs01_00063322 predicted 733
11 SASI_Hs01_00063316 predicted 1374
12 SASI_Hs01_00063320 predicted 2872
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031006 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048635 predicted 2815
2 SASI_Rn01_00048636 predicted 1240
3 SASI_Rn01_00048637 predicted 1467
4 SASI_Rn01_00048638 predicted 2113
5 SASI_Rn01_00048639 predicted 1341
6 SASI_Rn01_00048640 predicted 772
7 SASI_Rn01_00048641 predicted 867
8 SASI_Rn01_00048644 predicted 2445
9 SASI_Rn02_00264194 predicted 742
10 SASI_Rn02_00264195 predicted 1711
11 SASI_Rn01_00048642 predicted 695
12 SASI_Rn01_00048643 predicted 1387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038587 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060340 predicted 1297
2 SASI_Mm01_00060341 predicted 3429
3 SASI_Mm01_00060342 predicted 829
4 SASI_Mm02_00289597 predicted 1395
5 SASI_Mm01_00060343 predicted 1514
6 SASI_Mm01_00060344 predicted 1439
7 SASI_Mm01_00060345 predicted 1398
8 SASI_Mm01_00060346 predicted 1507
9 SASI_Mm01_00060347 predicted 2025
10 SASI_Mm01_00060348 predicted 3466
11 SASI_Mm01_00060349 predicted 817
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019655 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200105 predicted 1257
2 SASI_Mm01_00200106 predicted 3315
3 SASI_Mm01_00200107 predicted 796
4 SASI_Mm02_00324703 predicted 1356
5 SASI_Mm01_00200108 predicted 1483
6 SASI_Mm01_00200109 predicted 668
7 SASI_Mm01_00200110 predicted 1397
8 SASI_Mm01_00200111 predicted 653
9 SASI_Mm01_00200112 predicted 1363
10 SASI_Mm01_00200113 predicted 1468
11 SASI_Mm01_00200114 predicted 1987
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001111
VALIDATED
ADAR MISSION shRNA Bacterial Glycerol Stock
adenosine deaminase, RNA-specific
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111.3-2459s21c1
Sequence:CCGGTCACGAGCCCAAGTTCGTTTACTCGAGTAAACGAACTTGGGCTCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111.3-1171s21c1
Sequence:CCGGTTACCAAGGCCCGAGATATAACTCGAGTTATATCTCGGGCCTTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001111.3-6247s21c1
Sequence:CCGGGCCCACTGTTATCTTCACTTTCTCGAGAAAGTGAAGATAACAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111.3-1721s21c1
Sequence:CCGGGCTGTTAGAATATGCCCAGTTCTCGAGAACTGGGCATATTCTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111.3-2999s21c1
Sequence:CCGGGACTGCGAAGGATAGTATATTCTCGAGAATATACTATCCTTCGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001111.2-2589s1c1
Sequence:CCGGGCATGGGTTTCACAGAGGTAACTCGAGTTACCTCTGTGAAACCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001111.2-1517s1c1
Sequence:CCGGGCAGGGTATGTTGACTTTGAACTCGAGTTCAAAGTCAACATACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050788    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001111.2-6243s1c1
Sequence:CCGGGCCCACTGTTATCTTCACTTTCTCGAGAAAGTGAAGATAACAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001111.2-217s1c1
Sequence:CCGGCGGATACTACACCCATCCATTCTCGAGAATGGATGGGTGTAGTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001111.2-1708s1c1
Sequence:CCGGGCTGTTAGAATATGCCCAGTTCTCGAGAACTGGGCATATTCTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001111
VALIDATED
ADAR MISSION shRNA shRNA Plasmid DNA
adenosine deaminase, RNA-specific
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111.3-2459s21c1
Sequence:CCGGTCACGAGCCCAAGTTCGTTTACTCGAGTAAACGAACTTGGGCTCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111.3-1171s21c1
Sequence:CCGGTTACCAAGGCCCGAGATATAACTCGAGTTATATCTCGGGCCTTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001111.3-6247s21c1
Sequence:CCGGGCCCACTGTTATCTTCACTTTCTCGAGAAAGTGAAGATAACAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111.3-1721s21c1
Sequence:CCGGGCTGTTAGAATATGCCCAGTTCTCGAGAACTGGGCATATTCTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111.3-2999s21c1
Sequence:CCGGGACTGCGAAGGATAGTATATTCTCGAGAATATACTATCCTTCGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001111.2-2589s1c1
Sequence:CCGGGCATGGGTTTCACAGAGGTAACTCGAGTTACCTCTGTGAAACCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001111.2-1517s1c1
Sequence:CCGGGCAGGGTATGTTGACTTTGAACTCGAGTTCAAAGTCAACATACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050788    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001111.2-6243s1c1
Sequence:CCGGGCCCACTGTTATCTTCACTTTCTCGAGAAAGTGAAGATAACAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001111.2-217s1c1
Sequence:CCGGCGGATACTACACCCATCCATTCTCGAGAATGGATGGGTGTAGTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001111.2-1708s1c1
Sequence:CCGGGCTGTTAGAATATGCCCAGTTCTCGAGAACTGGGCATATTCTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001111
VALIDATED
ADAR MISSION shRNA Lentiviral Transduction Particles
adenosine deaminase, RNA-specific
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111.3-2459s21c1
Sequence:CCGGTCACGAGCCCAAGTTCGTTTACTCGAGTAAACGAACTTGGGCTCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111.3-1171s21c1
Sequence:CCGGTTACCAAGGCCCGAGATATAACTCGAGTTATATCTCGGGCCTTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001111.3-6247s21c1
Sequence:CCGGGCCCACTGTTATCTTCACTTTCTCGAGAAAGTGAAGATAACAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111.3-1721s21c1
Sequence:CCGGGCTGTTAGAATATGCCCAGTTCTCGAGAACTGGGCATATTCTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111.3-2999s21c1
Sequence:CCGGGACTGCGAAGGATAGTATATTCTCGAGAATATACTATCCTTCGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001111.2-2589s1c1
Sequence:CCGGGCATGGGTTTCACAGAGGTAACTCGAGTTACCTCTGTGAAACCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001111.2-1517s1c1
Sequence:CCGGGCAGGGTATGTTGACTTTGAACTCGAGTTCAAAGTCAACATACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050788    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001111.2-6243s1c1
Sequence:CCGGGCCCACTGTTATCTTCACTTTCTCGAGAAAGTGAAGATAACAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001111.2-217s1c1
Sequence:CCGGCGGATACTACACCCATCCATTCTCGAGAATGGATGGGTGTAGTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001111.2-1708s1c1
Sequence:CCGGGCTGTTAGAATATGCCCAGTTCTCGAGAACTGGGCATATTCTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019655
VALIDATED
ADAR MISSION shRNA Bacterial Glycerol Stock
adenosine deaminase, RNA-specific
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019655.2-1473s21c1
Sequence:CCGGGTCCCATGAACCTCGATTTAACTCGAGTTAAATCGAGGTTCATGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019655.2-3074s21c1
Sequence:CCGGATGGACTACGCTATCCCTTTACTCGAGTAAAGGGATAGCGTAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019655.2-664s21c1
Sequence:GTACCGGGTGAATCCAGATAGTTGTATCCTCGAGGATACAACTATCTGGATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019655.2-3586s21c1
Sequence:CCGGTTAATGGTAGAACCATAATAGCTCGAGCTATTATGGTTCTACCATTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019655.2-2596s21c1
Sequence:CCGGACTGCCAAGAACAGCATATTTCTCGAGAAATATGCTGTTCTTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019655.2-1263s1c1
Sequence:CCGGCCCAGATAACTTGAATAGTATCTCGAGATACTATTCAAGTTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019655.2-3116s1c1
Sequence:CCGGGCCGAGTCAGTGTTTATGATTCTCGAGAATCATAAACACTGACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019655.2-202s1c1
Sequence:CCGGGCTCCCTTGATTGGAATACAACTCGAGTTGTATTCCAATCAAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019655.2-3333s1c1
Sequence:CCGGGCTCTCTTATGGTGAAGCCAACTCGAGTTGGCTTCACCATAAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019655.2-1472s1c1
Sequence:CCGGCGTCCCATGAACCTCGATTTACTCGAGTAAATCGAGGTTCATGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019655
VALIDATED
ADAR MISSION shRNA shRNA Plasmid DNA
adenosine deaminase, RNA-specific
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019655.2-1473s21c1
Sequence:CCGGGTCCCATGAACCTCGATTTAACTCGAGTTAAATCGAGGTTCATGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019655.2-3074s21c1
Sequence:CCGGATGGACTACGCTATCCCTTTACTCGAGTAAAGGGATAGCGTAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019655.2-664s21c1
Sequence:GTACCGGGTGAATCCAGATAGTTGTATCCTCGAGGATACAACTATCTGGATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019655.2-3586s21c1
Sequence:CCGGTTAATGGTAGAACCATAATAGCTCGAGCTATTATGGTTCTACCATTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019655.2-2596s21c1
Sequence:CCGGACTGCCAAGAACAGCATATTTCTCGAGAAATATGCTGTTCTTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019655.2-1263s1c1
Sequence:CCGGCCCAGATAACTTGAATAGTATCTCGAGATACTATTCAAGTTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019655.2-3116s1c1
Sequence:CCGGGCCGAGTCAGTGTTTATGATTCTCGAGAATCATAAACACTGACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019655.2-202s1c1
Sequence:CCGGGCTCCCTTGATTGGAATACAACTCGAGTTGTATTCCAATCAAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019655.2-3333s1c1
Sequence:CCGGGCTCTCTTATGGTGAAGCCAACTCGAGTTGGCTTCACCATAAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019655.2-1472s1c1
Sequence:CCGGCGTCCCATGAACCTCGATTTACTCGAGTAAATCGAGGTTCATGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019655
VALIDATED
ADAR MISSION shRNA Lentiviral Transduction Particles
adenosine deaminase, RNA-specific
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019655.2-1473s21c1
Sequence:CCGGGTCCCATGAACCTCGATTTAACTCGAGTTAAATCGAGGTTCATGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019655.2-3074s21c1
Sequence:CCGGATGGACTACGCTATCCCTTTACTCGAGTAAAGGGATAGCGTAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019655.2-664s21c1
Sequence:GTACCGGGTGAATCCAGATAGTTGTATCCTCGAGGATACAACTATCTGGATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019655.2-3586s21c1
Sequence:CCGGTTAATGGTAGAACCATAATAGCTCGAGCTATTATGGTTCTACCATTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019655.2-2596s21c1
Sequence:CCGGACTGCCAAGAACAGCATATTTCTCGAGAAATATGCTGTTCTTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019655.2-1263s1c1
Sequence:CCGGCCCAGATAACTTGAATAGTATCTCGAGATACTATTCAAGTTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019655.2-3116s1c1
Sequence:CCGGGCCGAGTCAGTGTTTATGATTCTCGAGAATCATAAACACTGACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019655.2-202s1c1
Sequence:CCGGGCTCCCTTGATTGGAATACAACTCGAGTTGTATTCCAATCAAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019655.2-3333s1c1
Sequence:CCGGGCTCTCTTATGGTGAAGCCAACTCGAGTTGGCTTCACCATAAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019655.2-1472s1c1
Sequence:CCGGCGTCCCATGAACCTCGATTTACTCGAGTAAATCGAGGTTCATGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks