EMAIL THIS PAGE TO A FRIEND

ADARB1

adenosine deaminase, RNA-specific, B1

Synonyms: ADAR2 DRABA2 DRADA2 RED1
Gene ID:
Human(104) Summary: This gene encodes the enzyme responsible for pre-mRNA editing of the glutamate receptor subunit B by site-specific deamination of adenosines. Studies in rat found that this enzyme acted on its own pre-mRNA molecules to convert an AA dinucleotide to an AI dinucleotide which resulted in a new splice site. Alternative splicing of this gene results in several transcript variants, some of which have been characterized by the presence or absence of an ALU cassette insert and a short or long C-terminal region. [provided by RefSeq, Jul 2008]
Mouse(110532) adenosine deaminase, RNA-specific, B1
Rat(25367) adenosine deaminase, RNA-specific, B1
domestic guinea pig(100727365) adenosine deaminase, RNA-specific, B1
naked mole-rat(101704880) adenosine deaminase, RNA-specific, B1
sheep(101105469) adenosine deaminase, RNA-specific, B1
Domestic Rabbit(100339367) adenosine deaminase, RNA-specific, B1
chicken(374087) adenosine deaminase, RNA-specific, B1
cow(521761) adenosine deaminase, RNA-specific, B1
domestic cat(101082682) adenosine deaminase, RNA-specific, B1
dog(487809) adenosine deaminase, RNA-specific, B1
345 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130895 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_130895 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_130895 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001112 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001112 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001112 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU096691 MISSION® esiRNA esiRNA human ADARB1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033049 Rosetta Predictions human pricing
NM_001112 Rosetta Predictions human pricing
NM_015833 Rosetta Predictions human pricing
NM_015834 Rosetta Predictions human pricing
NM_001111055 Rosetta Predictions rat pricing
NM_001111056 Rosetta Predictions rat pricing
NM_001111057 Rosetta Predictions rat pricing
NM_012894 Rosetta Predictions rat pricing
NM_001024837 Rosetta Predictions mouse pricing
NM_001024838 Rosetta Predictions mouse pricing
NM_001024839 Rosetta Predictions mouse pricing
NM_001024840 Rosetta Predictions mouse pricing
NM_130895 Rosetta Predictions mouse pricing
NR_004429 Rosetta Predictions mouse pricing
NR_021486 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033049 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237747 predicted 1671
2 SASI_Hs01_00237748 predicted 1479
3 SASI_Hs01_00237749 predicted 1682
4 SASI_Hs01_00237750 predicted 1308
5 SASI_Hs01_00237751 predicted 1135
6 SASI_Hs01_00237752 predicted 840
7 SASI_Hs01_00237753 predicted 1219
8 SASI_Hs01_00237754 predicted 1232
9 SASI_Hs01_00237755 predicted 2214
10 SASI_Hs02_00307981 predicted 1301
11 SASI_Hs01_00237746 predicted 783
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222314 predicted 1557
2 SASI_Hs01_00222315 predicted 1361
3 SASI_Hs01_00222316 predicted 1559
4 SASI_Hs01_00222317 predicted 1188
5 SASI_Hs01_00222318 predicted 1025
6 SASI_Hs01_00222319 predicted 722
7 SASI_Hs01_00222320 predicted 1106
8 SASI_Hs01_00222321 predicted 1118
9 SASI_Hs01_00222322 predicted 2094
10 SASI_Hs02_00325394 predicted 1182
11 SASI_Hs01_00222313 predicted 664
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015833 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135204 predicted 1560
2 SASI_Hs01_00135205 predicted 1356
3 SASI_Hs01_00135206 predicted 1557
4 SASI_Hs01_00135207 predicted 1185
5 SASI_Hs01_00135208 predicted 1025
6 SASI_Hs01_00135209 predicted 726
7 SASI_Hs01_00135210 predicted 1106
8 SASI_Hs01_00135211 predicted 1113
9 SASI_Hs01_00135212 predicted 2216
10 SASI_Hs02_00348422 predicted 1181
11 SASI_Hs01_00135203 predicted 658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015834 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039151 predicted 827
2 SASI_Hs01_00039152 predicted 729
3 SASI_Hs01_00039153 predicted 2141
4 SASI_Hs01_00039154 predicted 1555
5 SASI_Hs01_00039155 predicted 1356
6 SASI_Hs02_00348423 predicted 597
7 SASI_Hs01_00039156 predicted 1102
8 SASI_Hs01_00039157 predicted 2246
9 SASI_Hs01_00039158 predicted 1538
10 SASI_Hs01_00039159 predicted 2815
11 SASI_Hs01_00039160 predicted 1252
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111055 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251432 predicted 1983
2 SASI_Rn02_00251433 predicted 1466
3 SASI_Rn02_00251434 predicted 1498
4 SASI_Rn02_00251435 predicted 1314
5 SASI_Rn02_00251436 predicted 705
6 SASI_Rn02_00251437 predicted 1168
7 SASI_Rn02_00251438 predicted 930
8 SASI_Rn02_00251439 predicted 708
9 SASI_Rn02_00251440 predicted 1426
10 SASI_Rn02_00251441 predicted 1455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111056 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251442 predicted 2059
2 SASI_Rn02_00251443 predicted 1511
3 SASI_Rn02_00251444 predicted 1544
4 SASI_Rn02_00251445 predicted 1359
5 SASI_Rn02_00251446 predicted 760
6 SASI_Rn02_00251447 predicted 1219
7 SASI_Rn02_00251448 predicted 983
8 SASI_Rn02_00251449 predicted 755
9 SASI_Rn02_00251450 predicted 1481
10 SASI_Rn02_00251451 predicted 1502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111057 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251452 predicted 2025
2 SASI_Rn02_00251453 predicted 1511
3 SASI_Rn02_00251454 predicted 1545
4 SASI_Rn02_00251455 predicted 1357
5 SASI_Rn02_00251456 predicted 752
6 SASI_Rn02_00251457 predicted 1221
7 SASI_Rn02_00251458 predicted 979
8 SASI_Rn02_00251459 predicted 751
9 SASI_Rn02_00251460 predicted 1475
10 SASI_Rn02_00251461 predicted 1501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012894 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067361 predicted 2017
2 SASI_Rn01_00067362 predicted 1467
3 SASI_Rn01_00067363 predicted 1496
4 SASI_Rn01_00067364 predicted 1314
5 SASI_Rn01_00067366 predicted 707
6 SASI_Rn02_00260416 predicted 1167
7 SASI_Rn02_00260417 predicted 935
8 SASI_Rn02_00260418 predicted 703
9 SASI_Rn02_00260419 predicted 1432
10 SASI_Rn02_00260420 predicted 1452
11 SASI_Rn01_00067360 predicted 1543
12 SASI_Rn01_00067365 predicted 1549
13 SASI_Rn01_00067367 predicted 1306
14 SASI_Rn01_00067368 predicted 951
15 SASI_Rn01_00067369 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024837 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287719 predicted 1088
2 SASI_Mm01_00139087 predicted 1494
3 SASI_Mm02_00287720 predicted 914
4 SASI_Mm01_00139088 predicted 734
5 SASI_Mm01_00139089 predicted 1340
6 SASI_Mm02_00287721 predicted 975
7 SASI_Mm01_00139092 predicted 951
8 SASI_Mm01_00139093 predicted 1524
9 SASI_Mm01_00139094 predicted 1192
10 SASI_Mm01_00139095 predicted 1227
11 SASI_Mm01_00139090 predicted 1447
12 SASI_Mm01_00139091 predicted 901
13 SASI_Mm01_00139096 predicted 1459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024838 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100088 predicted 1571
2 SASI_Mm01_00100089 predicted 810
3 SASI_Mm01_00100090 predicted 1411
4 SASI_Mm01_00100091 predicted 1512
5 SASI_Mm01_00100092 predicted 975
6 SASI_Mm01_00100093 predicted 1033
7 SASI_Mm01_00100094 predicted 1597
8 SASI_Mm01_00100095 predicted 1276
9 SASI_Mm01_00100096 predicted 1302
10 SASI_Mm01_00100097 predicted 1530
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024839 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064259 predicted 1537
2 SASI_Mm01_00064260 predicted 776
3 SASI_Mm01_00064261 predicted 1393
4 SASI_Mm01_00064262 predicted 1493
5 SASI_Mm01_00064263 predicted 952
6 SASI_Mm01_00064264 predicted 1008
7 SASI_Mm01_00064265 predicted 1574
8 SASI_Mm01_00064266 predicted 1250
9 SASI_Mm01_00064267 predicted 1275
10 SASI_Mm01_00064268 predicted 1508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024840 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133372 predicted 1539
2 SASI_Mm01_00133373 predicted 780
3 SASI_Mm01_00133374 predicted 1394
4 SASI_Mm01_00133375 predicted 1484
5 SASI_Mm01_00133376 predicted 952
6 SASI_Mm01_00133377 predicted 1008
7 SASI_Mm01_00133378 predicted 1567
8 SASI_Mm01_00133379 predicted 1250
9 SASI_Mm01_00133380 predicted 1272
10 SASI_Mm01_00133381 predicted 1502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130895 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338333 predicted 1090
2 SASI_Mm01_00157707 predicted 1495
3 SASI_Mm02_00338334 predicted 911
4 SASI_Mm01_00157708 predicted 725
5 SASI_Mm01_00157709 predicted 1341
6 SASI_Mm02_00338335 predicted 978
7 SASI_Mm01_00157712 predicted 953
8 SASI_Mm01_00157713 predicted 1519
9 SASI_Mm01_00157714 predicted 1198
10 SASI_Mm01_00157715 predicted 1225
11 SASI_Mm01_00157710 predicted 1443
12 SASI_Mm01_00157711 predicted 909
13 SASI_Mm01_00157716 predicted 1459
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_004429 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00354113 predicted 422
2 SASI_Mm02_00354114 predicted 1541
3 SASI_Mm02_00354115 predicted 3100
4 SASI_Mm02_00354116 predicted 3425
5 SASI_Mm02_00354117 predicted 5188
6 SASI_Mm02_00354118 predicted 1935
7 SASI_Mm02_00354119 predicted 776
8 SASI_Mm02_00354120 predicted 3337
9 SASI_Mm02_00354121 predicted 4936
10 SASI_Mm02_00354122 predicted 6099
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_021486 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00354418 predicted 429
2 SASI_Mm02_00354419 predicted 1539
3 SASI_Mm02_00354420 predicted 3066
4 SASI_Mm02_00354421 predicted 3399
5 SASI_Mm02_00354422 predicted 5153
6 SASI_Mm02_00354423 predicted 1908
7 SASI_Mm02_00354424 predicted 775
8 SASI_Mm02_00354425 predicted 3303
9 SASI_Mm02_00354426 predicted 4906
10 SASI_Mm02_00354427 predicted 6063
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130895
ADARB1 MISSION shRNA Bacterial Glycerol Stock
adenosine deaminase, RNA-specific, B1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130895.1-2454s1c1
Sequence:CCGGCCACTGGACATCAAGCATCATCTCGAGATGATGCTTGATGTCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130895.1-1629s1c1
Sequence:CCGGCCAGCAGATAGACATCCGAATCTCGAGATTCGGATGTCTATCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130895.1-2182s1c1
Sequence:CCGGAGATCACTAAGCCTACCACATCTCGAGATGTGGTAGGCTTAGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130895.1-939s1c1
Sequence:CCGGGTGATGATCTTGAATGAGCTACTCGAGTAGCTCATTCAAGATCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130895.3-1863s21c1
Sequence:CCGGACAATCCCTGTGCGCTCAAATCTCGAGATTTGAGCGCACAGGGATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130895.3-1520s21c1
Sequence:CCGGGAAGTGTATCAACGGTGAATACTCGAGTATTCACCGTTGATACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130895
ADARB1 MISSION shRNA shRNA Plasmid DNA
adenosine deaminase, RNA-specific, B1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130895.1-2454s1c1
Sequence:CCGGCCACTGGACATCAAGCATCATCTCGAGATGATGCTTGATGTCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130895.1-1629s1c1
Sequence:CCGGCCAGCAGATAGACATCCGAATCTCGAGATTCGGATGTCTATCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130895.1-2182s1c1
Sequence:CCGGAGATCACTAAGCCTACCACATCTCGAGATGTGGTAGGCTTAGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130895.1-939s1c1
Sequence:CCGGGTGATGATCTTGAATGAGCTACTCGAGTAGCTCATTCAAGATCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130895.3-1863s21c1
Sequence:CCGGACAATCCCTGTGCGCTCAAATCTCGAGATTTGAGCGCACAGGGATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130895.3-1520s21c1
Sequence:CCGGGAAGTGTATCAACGGTGAATACTCGAGTATTCACCGTTGATACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130895
ADARB1 MISSION shRNA Lentiviral Transduction Particles
adenosine deaminase, RNA-specific, B1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130895.1-2454s1c1
Sequence:CCGGCCACTGGACATCAAGCATCATCTCGAGATGATGCTTGATGTCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130895.1-1629s1c1
Sequence:CCGGCCAGCAGATAGACATCCGAATCTCGAGATTCGGATGTCTATCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130895.1-2182s1c1
Sequence:CCGGAGATCACTAAGCCTACCACATCTCGAGATGTGGTAGGCTTAGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130895.1-939s1c1
Sequence:CCGGGTGATGATCTTGAATGAGCTACTCGAGTAGCTCATTCAAGATCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130895.3-1863s21c1
Sequence:CCGGACAATCCCTGTGCGCTCAAATCTCGAGATTTGAGCGCACAGGGATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130895.3-1520s21c1
Sequence:CCGGGAAGTGTATCAACGGTGAATACTCGAGTATTCACCGTTGATACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001112
VALIDATED
ADARB1 MISSION shRNA Bacterial Glycerol Stock
adenosine deaminase, RNA-specific, B1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001112.1-1773s1c1
Sequence:CCGGGCCAGAATCTTCTCACCACATCTCGAGATGTGGTGAGAAGATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001112.1-1119s1c1
Sequence:CCGGCCCGTGATGATCTTGAACGAACTCGAGTTCGTTCAAGATCATCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001112.1-1611s1c1
Sequence:CCGGCGGAGATCCTTGCTCAGATTTCTCGAGAAATCTGAGCAAGGATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001112.1-1145s1c1
Sequence:CCGGCCCAGGACTCAAGTATGACTTCTCGAGAAGTCATACTTGAGTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001112.3-1742s21c1
Sequence:CCGGTGAAGGAGAATGTCCAGTTTCCTCGAGGAAACTGGACATTCTCCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001112.3-1588s21c1
Sequence:CCGGGATCGTGGCCTTGCATTAAATCTCGAGATTTAATGCAAGGCCACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001112.3-1840s21c1
Sequence:CCGGGATAGACACCCAAATCGTAAACTCGAGTTTACGATTTGGGTGTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001112.3-1656s21c1
Sequence:CCGGTTATACACAACTTGAGCTTTACTCGAGTAAAGCTCAAGTTGTGTATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001112.3-2925s21c1
Sequence:CCGGGAGCTAGGAATGTGGTTTATACTCGAGTATAAACCACATTCCTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001112.3-857s21c1
Sequence:CCGGCTTTCGTTCAGTTTCCTAATGCTCGAGCATTAGGAAACTGAACGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001112.3-2253s21c1
Sequence:CCGGCTCCGCTATTGAGGTCATCAACTCGAGTTGATGACCTCAATAGCGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001112.3-2117s21c1
Sequence:CCGGACCAGCGGATCTCCAACATAGCTCGAGCTATGTTGGAGATCCGCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001112
VALIDATED
ADARB1 MISSION shRNA shRNA Plasmid DNA
adenosine deaminase, RNA-specific, B1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001112.1-1773s1c1
Sequence:CCGGGCCAGAATCTTCTCACCACATCTCGAGATGTGGTGAGAAGATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001112.1-1119s1c1
Sequence:CCGGCCCGTGATGATCTTGAACGAACTCGAGTTCGTTCAAGATCATCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001112.1-1611s1c1
Sequence:CCGGCGGAGATCCTTGCTCAGATTTCTCGAGAAATCTGAGCAAGGATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001112.1-1145s1c1
Sequence:CCGGCCCAGGACTCAAGTATGACTTCTCGAGAAGTCATACTTGAGTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001112.3-1742s21c1
Sequence:CCGGTGAAGGAGAATGTCCAGTTTCCTCGAGGAAACTGGACATTCTCCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001112.3-1588s21c1
Sequence:CCGGGATCGTGGCCTTGCATTAAATCTCGAGATTTAATGCAAGGCCACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001112.3-1840s21c1
Sequence:CCGGGATAGACACCCAAATCGTAAACTCGAGTTTACGATTTGGGTGTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001112.3-1656s21c1
Sequence:CCGGTTATACACAACTTGAGCTTTACTCGAGTAAAGCTCAAGTTGTGTATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001112.3-2925s21c1
Sequence:CCGGGAGCTAGGAATGTGGTTTATACTCGAGTATAAACCACATTCCTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001112.3-857s21c1
Sequence:CCGGCTTTCGTTCAGTTTCCTAATGCTCGAGCATTAGGAAACTGAACGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001112.3-2253s21c1
Sequence:CCGGCTCCGCTATTGAGGTCATCAACTCGAGTTGATGACCTCAATAGCGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001112.3-2117s21c1
Sequence:CCGGACCAGCGGATCTCCAACATAGCTCGAGCTATGTTGGAGATCCGCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001112
VALIDATED
ADARB1 MISSION shRNA Lentiviral Transduction Particles
adenosine deaminase, RNA-specific, B1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001112.1-1773s1c1
Sequence:CCGGGCCAGAATCTTCTCACCACATCTCGAGATGTGGTGAGAAGATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001112.1-1119s1c1
Sequence:CCGGCCCGTGATGATCTTGAACGAACTCGAGTTCGTTCAAGATCATCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001112.1-1611s1c1
Sequence:CCGGCGGAGATCCTTGCTCAGATTTCTCGAGAAATCTGAGCAAGGATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001112.1-1145s1c1
Sequence:CCGGCCCAGGACTCAAGTATGACTTCTCGAGAAGTCATACTTGAGTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001112.3-1742s21c1
Sequence:CCGGTGAAGGAGAATGTCCAGTTTCCTCGAGGAAACTGGACATTCTCCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001112.3-1588s21c1
Sequence:CCGGGATCGTGGCCTTGCATTAAATCTCGAGATTTAATGCAAGGCCACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001112.3-1840s21c1
Sequence:CCGGGATAGACACCCAAATCGTAAACTCGAGTTTACGATTTGGGTGTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001112.3-1656s21c1
Sequence:CCGGTTATACACAACTTGAGCTTTACTCGAGTAAAGCTCAAGTTGTGTATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001112.3-2925s21c1
Sequence:CCGGGAGCTAGGAATGTGGTTTATACTCGAGTATAAACCACATTCCTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001112.3-857s21c1
Sequence:CCGGCTTTCGTTCAGTTTCCTAATGCTCGAGCATTAGGAAACTGAACGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001112.3-2253s21c1
Sequence:CCGGCTCCGCTATTGAGGTCATCAACTCGAGTTGATGACCTCAATAGCGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001112.3-2117s21c1
Sequence:CCGGACCAGCGGATCTCCAACATAGCTCGAGCTATGTTGGAGATCCGCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks