EMAIL THIS PAGE TO A FRIEND

ADARB2-AS1

ADARB2 antisense RNA 1

22 Gene Product Result for
Synonyms: C10orf109 NCRNA00168 bA466B20.1
Species: Human ADARB2-AS1(642394)
UniProtKB ID: A8MUL3
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001098830 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001098830 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001098830 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098830 Rosetta Predictions human pricing
XM_931034 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098830 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320104 predicted 221
2 SASI_Hs02_00320105 predicted 236
3 SASI_Hs02_00320106 predicted 478
4 SASI_Hs02_00320107 predicted 284
5 SASI_Hs02_00320108 predicted 269
6 SASI_Hs02_00320109 predicted 482
7 SASI_Hs02_00320110 predicted 452
8 SASI_Hs02_00320111 predicted 462
9 SASI_Hs02_00320112 predicted 278
10 SASI_Hs02_00320113 predicted 237
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931034 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00259882 predicted 367
2 SASI_Hs01_00259883 predicted 368
3 SASI_Hs01_00259884 predicted 372
4 SASI_Hs01_00259885 predicted 364
5 SASI_Hs01_00259886 predicted 362
6 SASI_Hs01_00259887 predicted 361
7 SASI_Hs01_00259888 predicted 371
8 SASI_Hs01_00259889 predicted 370
9 SASI_Hs01_00259890 predicted 226
10 SASI_Hs01_00259891 predicted 226
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001098830
ADARB2-AS1 MISSION shRNA Bacterial Glycerol Stock
ADARB2 antisense RNA 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098830.1-378s21c1
Sequence:CCGGTGCCCATGTCAACAGAGTTGTCTCGAGACAACTCTGTTGACATGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098830.1-329s21c1
Sequence:CCGGTGCAACCAGAGCTCAGCAAACCTCGAGGTTTGCTGAGCTCTGGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098830.1-453s21c1
Sequence:CCGGGCTCTGTCCCTGGAAGCATATCTCGAGATATGCTTCCAGGGACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098830.1-290s21c1
Sequence:CCGGGTCTGTTCTCACATCACATTGCTCGAGCAATGTGATGTGAGAACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098830.1-231s21c1
Sequence:CCGGACTTCGCTGCTTGCCTCATCACTCGAGTGATGAGGCAAGCAGCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001098830
ADARB2-AS1 MISSION shRNA shRNA Plasmid DNA
ADARB2 antisense RNA 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098830.1-378s21c1
Sequence:CCGGTGCCCATGTCAACAGAGTTGTCTCGAGACAACTCTGTTGACATGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098830.1-329s21c1
Sequence:CCGGTGCAACCAGAGCTCAGCAAACCTCGAGGTTTGCTGAGCTCTGGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098830.1-453s21c1
Sequence:CCGGGCTCTGTCCCTGGAAGCATATCTCGAGATATGCTTCCAGGGACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098830.1-290s21c1
Sequence:CCGGGTCTGTTCTCACATCACATTGCTCGAGCAATGTGATGTGAGAACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098830.1-231s21c1
Sequence:CCGGACTTCGCTGCTTGCCTCATCACTCGAGTGATGAGGCAAGCAGCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001098830
ADARB2-AS1 MISSION shRNA Lentiviral Transduction Particles
ADARB2 antisense RNA 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098830.1-378s21c1
Sequence:CCGGTGCCCATGTCAACAGAGTTGTCTCGAGACAACTCTGTTGACATGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098830.1-329s21c1
Sequence:CCGGTGCAACCAGAGCTCAGCAAACCTCGAGGTTTGCTGAGCTCTGGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098830.1-453s21c1
Sequence:CCGGGCTCTGTCCCTGGAAGCATATCTCGAGATATGCTTCCAGGGACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098830.1-290s21c1
Sequence:CCGGGTCTGTTCTCACATCACATTGCTCGAGCAATGTGATGTGAGAACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098830.1-231s21c1
Sequence:CCGGACTTCGCTGCTTGCCTCATCACTCGAGTGATGAGGCAAGCAGCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks