EMAIL THIS PAGE TO A FRIEND

ADARB2

adenosine deaminase, RNA-specific, B2 (non-functional)

49 Gene Product Result for
Synonyms: ADAR3 RED2
UniProtKB ID: Q9NS39, B2RPJ5, Q5VUT6
Gene ID:
Human(105) Summary: This gene encodes a member of the double-stranded RNA adenosine deaminase family of RNA-editing enzymes and may play a regulatory role in RNA editing. [provided by RefSeq, Jul 2008]
Mouse(94191) adenosine deaminase, RNA-specific, B2
Rat(117088) adenosine deaminase, RNA-specific, B2
Zebrafish(558149) adenosine deaminase, RNA-specific, B2 (RED2 homolog rat)
chicken(420461) adenosine deaminase, RNA-specific, B2
dog(487153) adenosine deaminase, RNA-specific, B2
cow(524061) adenosine deaminase, RNA-specific, B2
domestic cat(101095749) adenosine deaminase, RNA-specific, B2
naked mole-rat(101701033) adenosine deaminase, RNA-specific, B2 (non-functional)
domestic guinea pig(100734083) adenosine deaminase, RNA-specific, B2 (non-functional)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018702 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018702 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018702 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_052977 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_052977 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_052977 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU146351 MISSION® esiRNA esiRNA human ADARB2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018702 Rosetta Predictions human pricing
NM_133302 Rosetta Predictions rat pricing
NM_052977 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018702 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352231 predicted 3063
2 SASI_Hs01_00090257 predicted 2483
3 SASI_Hs01_00090258 predicted 1749
4 SASI_Hs01_00090259 predicted 2748
5 SASI_Hs02_00352232 predicted 2565
6 SASI_Hs01_00090260 predicted 1747
7 SASI_Hs01_00090261 predicted 1795
8 SASI_Hs01_00090262 predicted 2437
9 SASI_Hs01_00090263 predicted 1810
10 SASI_Hs01_00090264 predicted 3010
11 SASI_Hs01_00090265 predicted 2792
12 SASI_Hs01_00090266 predicted 2783
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133302 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037758 predicted 1171
2 SASI_Rn01_00037759 predicted 414
3 SASI_Rn01_00037760 predicted 1823
4 SASI_Rn01_00037761 predicted 642
5 SASI_Rn01_00037762 predicted 1818
6 SASI_Rn01_00037763 predicted 1490
7 SASI_Rn01_00037764 predicted 1725
8 SASI_Rn01_00037765 predicted 2005
9 SASI_Rn01_00037766 predicted 1244
10 SASI_Rn01_00037767 predicted 1447
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052977 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140497 predicted 1819
2 SASI_Mm01_00140498 predicted 2528
3 SASI_Mm01_00140499 predicted 1805
4 SASI_Mm01_00140500 predicted 1742
5 SASI_Mm01_00140501 predicted 2520
6 SASI_Mm01_00140502 predicted 1466
7 SASI_Mm01_00140503 predicted 1998
8 SASI_Mm01_00140504 predicted 1231
9 SASI_Mm01_00140506 predicted 1438
10 SASI_Mm02_00337498 predicted 2452
11 SASI_Mm01_00140505 predicted 1416
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018702
ADARB2 MISSION shRNA Bacterial Glycerol Stock
adenosine deaminase, RNA-specific, B2 (non-functional)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018702.2-2812s21c1
Sequence:CCGGGCACACGCACTGTTGAGTTAGCTCGAGCTAACTCAACAGTGCGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018702.2-491s21c1
Sequence:CCGGGTCAACCTTCCTCGCTCCTTTCTCGAGAAAGGAGCGAGGAAGGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018702.2-519s21c1
Sequence:CCGGCTGAGTCCTGGCATCACAAACCTCGAGGTTTGTGATGCCAGGACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018702.2-412s21c1
Sequence:CCGGGGCTGAGCAGTCAACTCAAATCTCGAGATTTGAGTTGACTGCTCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018702.2-2714s21c1
Sequence:CCGGCACGCGAGTGTGCAATGTTTGCTCGAGCAAACATTGCACACTCGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018702.1-423s1c1
Sequence:CCGGCCAAGCGGAAAGATAAAGTAACTCGAGTTACTTTATCTTTCCGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018702.1-1718s1c1
Sequence:CCGGCGATCGATATTCGTGCGGTTACTCGAGTAACCGCACGAATATCGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018702.1-1760s1c1
Sequence:CCGGCGAGAGAACATCCTCTTCCATCTCGAGATGGAAGAGGATGTTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018702.1-2533s1c1
Sequence:CCGGGCAGTTTCTACTGACTCTCTACTCGAGTAGAGAGTCAGTAGAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018702.1-2444s1c1
Sequence:CCGGCACACCTACCAGTCTGTGAAACTCGAGTTTCACAGACTGGTAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018702
ADARB2 MISSION shRNA shRNA Plasmid DNA
adenosine deaminase, RNA-specific, B2 (non-functional)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018702.2-2812s21c1
Sequence:CCGGGCACACGCACTGTTGAGTTAGCTCGAGCTAACTCAACAGTGCGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018702.2-491s21c1
Sequence:CCGGGTCAACCTTCCTCGCTCCTTTCTCGAGAAAGGAGCGAGGAAGGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018702.2-519s21c1
Sequence:CCGGCTGAGTCCTGGCATCACAAACCTCGAGGTTTGTGATGCCAGGACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018702.2-412s21c1
Sequence:CCGGGGCTGAGCAGTCAACTCAAATCTCGAGATTTGAGTTGACTGCTCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018702.2-2714s21c1
Sequence:CCGGCACGCGAGTGTGCAATGTTTGCTCGAGCAAACATTGCACACTCGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018702.1-423s1c1
Sequence:CCGGCCAAGCGGAAAGATAAAGTAACTCGAGTTACTTTATCTTTCCGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018702.1-1718s1c1
Sequence:CCGGCGATCGATATTCGTGCGGTTACTCGAGTAACCGCACGAATATCGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018702.1-1760s1c1
Sequence:CCGGCGAGAGAACATCCTCTTCCATCTCGAGATGGAAGAGGATGTTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018702.1-2533s1c1
Sequence:CCGGGCAGTTTCTACTGACTCTCTACTCGAGTAGAGAGTCAGTAGAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018702.1-2444s1c1
Sequence:CCGGCACACCTACCAGTCTGTGAAACTCGAGTTTCACAGACTGGTAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018702
ADARB2 MISSION shRNA Lentiviral Transduction Particles
adenosine deaminase, RNA-specific, B2 (non-functional)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018702.2-2812s21c1
Sequence:CCGGGCACACGCACTGTTGAGTTAGCTCGAGCTAACTCAACAGTGCGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018702.2-491s21c1
Sequence:CCGGGTCAACCTTCCTCGCTCCTTTCTCGAGAAAGGAGCGAGGAAGGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018702.2-519s21c1
Sequence:CCGGCTGAGTCCTGGCATCACAAACCTCGAGGTTTGTGATGCCAGGACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018702.2-412s21c1
Sequence:CCGGGGCTGAGCAGTCAACTCAAATCTCGAGATTTGAGTTGACTGCTCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018702.2-2714s21c1
Sequence:CCGGCACGCGAGTGTGCAATGTTTGCTCGAGCAAACATTGCACACTCGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018702.1-423s1c1
Sequence:CCGGCCAAGCGGAAAGATAAAGTAACTCGAGTTACTTTATCTTTCCGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018702.1-1718s1c1
Sequence:CCGGCGATCGATATTCGTGCGGTTACTCGAGTAACCGCACGAATATCGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018702.1-1760s1c1
Sequence:CCGGCGAGAGAACATCCTCTTCCATCTCGAGATGGAAGAGGATGTTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018702.1-2533s1c1
Sequence:CCGGGCAGTTTCTACTGACTCTCTACTCGAGTAGAGAGTCAGTAGAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018702.1-2444s1c1
Sequence:CCGGCACACCTACCAGTCTGTGAAACTCGAGTTTCACAGACTGGTAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052977
ADARB2 MISSION shRNA Bacterial Glycerol Stock
adenosine deaminase, RNA-specific, B2 (non-functional)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119782    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052977.2-3097s1c1
Sequence:CCGGGCAGCCAAAGTGAAAGCTATACTCGAGTATAGCTTTCACTTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052977.2-378s1c1
Sequence:CCGGGAGGTCCAAGAGGAAAGACAACTCGAGTTGTCTTTCCTCTTGGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052977.2-1483s1c1
Sequence:CCGGGCAGGAATCGTCATGACCAAACTCGAGTTTGGTCATGACGATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052977.2-955s1c1
Sequence:CCGGGACACGTTGTTCAAGGAGTTTCTCGAGAAACTCCTTGAACAACGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052977.2-2248s1c1
Sequence:CCGGGCCGACCTGGAGATCATTAATCTCGAGATTAATGATCTCCAGGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052977
ADARB2 MISSION shRNA shRNA Plasmid DNA
adenosine deaminase, RNA-specific, B2 (non-functional)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119782    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052977.2-3097s1c1
Sequence:CCGGGCAGCCAAAGTGAAAGCTATACTCGAGTATAGCTTTCACTTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052977.2-378s1c1
Sequence:CCGGGAGGTCCAAGAGGAAAGACAACTCGAGTTGTCTTTCCTCTTGGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052977.2-1483s1c1
Sequence:CCGGGCAGGAATCGTCATGACCAAACTCGAGTTTGGTCATGACGATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052977.2-955s1c1
Sequence:CCGGGACACGTTGTTCAAGGAGTTTCTCGAGAAACTCCTTGAACAACGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052977.2-2248s1c1
Sequence:CCGGGCCGACCTGGAGATCATTAATCTCGAGATTAATGATCTCCAGGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052977
ADARB2 MISSION shRNA Lentiviral Transduction Particles
adenosine deaminase, RNA-specific, B2 (non-functional)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119782    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052977.2-3097s1c1
Sequence:CCGGGCAGCCAAAGTGAAAGCTATACTCGAGTATAGCTTTCACTTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052977.2-378s1c1
Sequence:CCGGGAGGTCCAAGAGGAAAGACAACTCGAGTTGTCTTTCCTCTTGGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052977.2-1483s1c1
Sequence:CCGGGCAGGAATCGTCATGACCAAACTCGAGTTTGGTCATGACGATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052977.2-955s1c1
Sequence:CCGGGACACGTTGTTCAAGGAGTTTCTCGAGAAACTCCTTGAACAACGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052977.2-2248s1c1
Sequence:CCGGGCCGACCTGGAGATCATTAATCTCGAGATTAATGATCTCCAGGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks