EMAIL THIS PAGE TO A FRIEND

ADAT1

adenosine deaminase, tRNA-specific 1

52 Gene Product Result for
Synonyms: HADAT1
UniProtKB ID: Q9BUB4, Q9NVB7, Q9UNG3
Gene ID:
Human(23536) Summary: This gene is a member of the ADAR (adenosine deaminase acting on RNA) family. Using site-specific adenosine modification, proteins encoded by these genes participate in the pre-mRNA editing of nuclear transcripts. The protein encoded by this gene, tRNA-specific adenosine deaminase 1, is responsible for the deamination of adenosine 37 to inosine in eukaryotic tRNA. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2010]
Mouse(30947) adenosine deaminase, tRNA-specific 1
Rat(690810) adenosine deaminase, tRNA-specific 1
Zebrafish(792614) adenosine deaminase, tRNA-specific 1
chicken(415886) adenosine deaminase, tRNA-specific 1
dog(489706) adenosine deaminase, tRNA-specific 1
domestic cat(101092319) adenosine deaminase, tRNA-specific 1
cow(618521) adenosine deaminase, tRNA-specific 1
Horse(100069032) adenosine deaminase, tRNA-specific 1
domestic guinea pig(100725126) adenosine deaminase, tRNA-specific 1
naked mole-rat(101705855) adenosine deaminase, tRNA-specific 1
sheep(101118042) adenosine deaminase, tRNA-specific 1
Domestic Rabbit(100343387) adenosine deaminase, tRNA-specific 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV40718 Anti-ADAT1 antibody produced in rabbit affinity isolated antibody guinea pig, rat, mouse, canine, horse, human
immunohistochemistry, western blot pricing
AV40717 Anti-ADAT1 antibody produced in rabbit IgG fraction of antiserum horse, bovine, mouse, canine, zebrafish, guinea pig, rat, human, rabbit
immunohistochemistry, western blot pricing
HPA040713 Anti-ADAT1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA040903 Anti-ADAT1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012091 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012091 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012091 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013925 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013925 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013925 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU135771 MISSION® esiRNA esiRNA human ADAT1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012091 Rosetta Predictions human pricing
NM_001109611 Rosetta Predictions rat pricing
NM_013925 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012091 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091485 predicted 1065
2 SASI_Hs01_00091486 predicted 1130
3 SASI_Hs01_00091488 predicted 1701
4 SASI_Hs01_00091490 predicted 1386
5 SASI_Hs01_00091491 predicted 601
6 SASI_Hs01_00091492 predicted 1318
7 SASI_Hs01_00091493 predicted 882
8 SASI_Hs01_00091494 predicted 1317
9 SASI_Hs02_00343591 predicted 1132
10 SASI_Hs02_00343592 predicted 246
11 SASI_Hs01_00091487 predicted 1205
12 SASI_Hs01_00091489 predicted 547
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109611 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250072 predicted 703
2 SASI_Rn02_00250073 predicted 1623
3 SASI_Rn02_00250074 predicted 1653
4 SASI_Rn02_00250075 predicted 323
5 SASI_Rn02_00250076 predicted 305
6 SASI_Rn02_00250077 predicted 1034
7 SASI_Rn02_00250078 predicted 1097
8 SASI_Rn02_00250079 predicted 1238
9 SASI_Rn02_00250080 predicted 929
10 SASI_Rn02_00250081 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013925 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130950 predicted 800
2 SASI_Mm01_00130951 predicted 680
3 SASI_Mm01_00130952 predicted 1527
4 SASI_Mm02_00323020 predicted 416
5 SASI_Mm01_00130953 predicted 329
6 SASI_Mm01_00130954 predicted 441
7 SASI_Mm01_00130956 predicted 1105
8 SASI_Mm02_00323021 predicted 1217
9 SASI_Mm01_00130957 predicted 715
10 SASI_Mm01_00130959 predicted 653
11 SASI_Mm01_00130955 predicted 329
12 SASI_Mm01_00130958 predicted 315
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012091
VALIDATED
ADAT1 MISSION shRNA Bacterial Glycerol Stock
adenosine deaminase, tRNA-specific 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012091.2-1821s21c1
Sequence:CCGGCCTCACTATCTGACTTCCATTCTCGAGAATGGAAGTCAGATAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012091.2-180s21c1
Sequence:CCGGGCCAAACCATGAGTGGACATTCTCGAGAATGTCCACTCATGGTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012091.2-867s21c1
Sequence:CCGGCGTTTATAGAACTGGAGCCAACTCGAGTTGGCTCCAGTTCTATAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012091.2-1175s21c1
Sequence:CCGGGCTTCGGAGTTCAAGAATTAACTCGAGTTAATTCTTGAACTCCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078258    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_012091.2-1821s1c1
Sequence:CCGGCCTCACTATCTGACTTCCATTCTCGAGAATGGAAGTCAGATAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_012091.2-180s1c1
Sequence:CCGGGCCAAACCATGAGTGGACATTCTCGAGAATGTCCACTCATGGTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_012091.2-853s1c1
Sequence:CCGGGCCAAAGTGACAGACGTTTATCTCGAGATAAACGTCTGTCACTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_012091.2-867s1c1
Sequence:CCGGCGTTTATAGAACTGGAGCCAACTCGAGTTGGCTCCAGTTCTATAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012091.2-1175s1c1
Sequence:CCGGGCTTCGGAGTTCAAGAATTAACTCGAGTTAATTCTTGAACTCCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012091
VALIDATED
ADAT1 MISSION shRNA shRNA Plasmid DNA
adenosine deaminase, tRNA-specific 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012091.2-1821s21c1
Sequence:CCGGCCTCACTATCTGACTTCCATTCTCGAGAATGGAAGTCAGATAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012091.2-180s21c1
Sequence:CCGGGCCAAACCATGAGTGGACATTCTCGAGAATGTCCACTCATGGTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012091.2-867s21c1
Sequence:CCGGCGTTTATAGAACTGGAGCCAACTCGAGTTGGCTCCAGTTCTATAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012091.2-1175s21c1
Sequence:CCGGGCTTCGGAGTTCAAGAATTAACTCGAGTTAATTCTTGAACTCCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078258    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_012091.2-1821s1c1
Sequence:CCGGCCTCACTATCTGACTTCCATTCTCGAGAATGGAAGTCAGATAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_012091.2-180s1c1
Sequence:CCGGGCCAAACCATGAGTGGACATTCTCGAGAATGTCCACTCATGGTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_012091.2-853s1c1
Sequence:CCGGGCCAAAGTGACAGACGTTTATCTCGAGATAAACGTCTGTCACTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_012091.2-867s1c1
Sequence:CCGGCGTTTATAGAACTGGAGCCAACTCGAGTTGGCTCCAGTTCTATAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012091.2-1175s1c1
Sequence:CCGGGCTTCGGAGTTCAAGAATTAACTCGAGTTAATTCTTGAACTCCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012091
VALIDATED
ADAT1 MISSION shRNA Lentiviral Transduction Particles
adenosine deaminase, tRNA-specific 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012091.2-1821s21c1
Sequence:CCGGCCTCACTATCTGACTTCCATTCTCGAGAATGGAAGTCAGATAGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012091.2-180s21c1
Sequence:CCGGGCCAAACCATGAGTGGACATTCTCGAGAATGTCCACTCATGGTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012091.2-867s21c1
Sequence:CCGGCGTTTATAGAACTGGAGCCAACTCGAGTTGGCTCCAGTTCTATAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012091.2-1175s21c1
Sequence:CCGGGCTTCGGAGTTCAAGAATTAACTCGAGTTAATTCTTGAACTCCGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078258    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_012091.2-1821s1c1
Sequence:CCGGCCTCACTATCTGACTTCCATTCTCGAGAATGGAAGTCAGATAGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_012091.2-180s1c1
Sequence:CCGGGCCAAACCATGAGTGGACATTCTCGAGAATGTCCACTCATGGTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_012091.2-853s1c1
Sequence:CCGGGCCAAAGTGACAGACGTTTATCTCGAGATAAACGTCTGTCACTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_012091.2-867s1c1
Sequence:CCGGCGTTTATAGAACTGGAGCCAACTCGAGTTGGCTCCAGTTCTATAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012091.2-1175s1c1
Sequence:CCGGGCTTCGGAGTTCAAGAATTAACTCGAGTTAATTCTTGAACTCCGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013925
ADAT1 MISSION shRNA Bacterial Glycerol Stock
adenosine deaminase, tRNA-specific 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013925.2-635s1c1
Sequence:CCGGGCTGTCCTGTCATCAGAAGTTCTCGAGAACTTCTGATGACAGGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013925.2-875s1c1
Sequence:CCGGCCAATGGAATAGCTTCAGGTACTCGAGTACCTGAAGCTATTCCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013925.2-189s1c1
Sequence:CCGGGCTGTGCTATGCACACTATAACTCGAGTTATAGTGTGCATAGCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013925.2-1636s1c1
Sequence:CCGGCCACCCGACTACCACCAATTTCTCGAGAAATTGGTGGTAGTCGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119777    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013925.2-2801s1c1
Sequence:CCGGGCCTTAATTTCCTACAACAAACTCGAGTTTGTTGTAGGAAATTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013925
ADAT1 MISSION shRNA shRNA Plasmid DNA
adenosine deaminase, tRNA-specific 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013925.2-635s1c1
Sequence:CCGGGCTGTCCTGTCATCAGAAGTTCTCGAGAACTTCTGATGACAGGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013925.2-875s1c1
Sequence:CCGGCCAATGGAATAGCTTCAGGTACTCGAGTACCTGAAGCTATTCCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013925.2-189s1c1
Sequence:CCGGGCTGTGCTATGCACACTATAACTCGAGTTATAGTGTGCATAGCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013925.2-1636s1c1
Sequence:CCGGCCACCCGACTACCACCAATTTCTCGAGAAATTGGTGGTAGTCGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119777    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013925.2-2801s1c1
Sequence:CCGGGCCTTAATTTCCTACAACAAACTCGAGTTTGTTGTAGGAAATTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013925
ADAT1 MISSION shRNA Lentiviral Transduction Particles
adenosine deaminase, tRNA-specific 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013925.2-635s1c1
Sequence:CCGGGCTGTCCTGTCATCAGAAGTTCTCGAGAACTTCTGATGACAGGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013925.2-875s1c1
Sequence:CCGGCCAATGGAATAGCTTCAGGTACTCGAGTACCTGAAGCTATTCCATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013925.2-189s1c1
Sequence:CCGGGCTGTGCTATGCACACTATAACTCGAGTTATAGTGTGCATAGCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013925.2-1636s1c1
Sequence:CCGGCCACCCGACTACCACCAATTTCTCGAGAAATTGGTGGTAGTCGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119777    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013925.2-2801s1c1
Sequence:CCGGGCCTTAATTTCCTACAACAAACTCGAGTTTGTTGTAGGAAATTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)