EMAIL THIS PAGE TO A FRIEND

ADAT2

adenosine deaminase, tRNA-specific 2

Synonyms: DEADC1 TAD2 dJ20N2 dJ20N2.1
UniProtKB ID: Q7Z6V5, A6NL12, B3KWY3, Q7Z327, Q8IY39
Gene ID:
Mouse(66757) adenosine deaminase, tRNA-specific 2
Rat(361453) adenosine deaminase, tRNA-specific 2
sheep(101117852) adenosine deaminase, tRNA-specific 2
naked mole-rat(101724765) adenosine deaminase, tRNA-specific 2
domestic guinea pig(100733583) adenosine deaminase, tRNA-specific 2
Zebrafish(100034610) adenosine deaminase, tRNA-specific 2, TAD2 homolog (S. cerevisiae)
chicken(421670) adenosine deaminase, tRNA-specific 2
domestic cat(101095101) adenosine deaminase, tRNA-specific 2
cow(615418) adenosine deaminase, tRNA-specific 2
dog(100686906) adenosine deaminase, tRNA-specific 2
136 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA035479 Anti-ADAT2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025748 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025748 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025748 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182503 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182503 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182503 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182503 Rosetta Predictions human pricing
NM_001115028 Rosetta Predictions rat pricing
NM_025748 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182503 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174499 predicted 788
2 SASI_Hs02_00370559 predicted 278
3 SASI_Hs01_00174500 predicted 609
4 SASI_Hs02_00370560 predicted 748
5 SASI_Hs01_00174501 predicted 874
6 SASI_Hs01_00174503 predicted 474
7 SASI_Hs01_00174504 predicted 433
8 SASI_Hs01_00174505 predicted 676
9 SASI_Hs01_00174506 predicted 405
10 SASI_Hs02_00370561 predicted 307
11 SASI_Hs01_00174502 predicted 931
12 SASI_Hs01_00174507 predicted 940
13 SASI_Hs01_00174508 predicted 1083
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115028 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252453 predicted 215
2 SASI_Rn02_00252454 predicted 493
3 SASI_Rn02_00252455 predicted 787
4 SASI_Rn02_00252456 predicted 843
5 SASI_Rn02_00252457 predicted 388
6 SASI_Rn02_00252458 predicted 781
7 SASI_Rn02_00252459 predicted 445
8 SASI_Rn02_00252460 predicted 684
9 SASI_Rn02_00252461 predicted 447
10 SASI_Rn02_00252462 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025748 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063563 predicted 931
2 SASI_Mm02_00328947 predicted 403
3 SASI_Mm01_00063564 predicted 849
4 SASI_Mm01_00063565 predicted 746
5 SASI_Mm01_00063566 predicted 580
6 SASI_Mm01_00063567 predicted 489
7 SASI_Mm01_00063568 predicted 753
8 SASI_Mm01_00063569 predicted 660
9 SASI_Mm01_00063570 predicted 479
10 SASI_Mm01_00063571 predicted 873
11 SASI_Mm01_00063572 predicted 935
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025748
VALIDATED
ADAT2 MISSION shRNA Bacterial Glycerol Stock
adenosine deaminase, tRNA-specific 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025748.2-542s1c1
Sequence:CCGGGCTCCTAAAGACCTTCTACAACTCGAGTTGTAGAAGGTCTTTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025748.2-261s1c1
Sequence:CCGGGCTGAAATGGTGGCCATTGATCTCGAGATCAATGGCCACCATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025748.2-215s1c1
Sequence:CCGGGAAGGGAACAAATGAAGTGAACTCGAGTTCACTTCATTTGTTCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025748.2-483s1c1
Sequence:CCGGCCCAATACTGGAAGACCGTTTCTCGAGAAACGGTCTTCCAGTATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025748.2-551s1c1
Sequence:CCGGGACCTTCTACAAACAGGAGAACTCGAGTTCTCCTGTTTGTAGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025748
VALIDATED
ADAT2 MISSION shRNA shRNA Plasmid DNA
adenosine deaminase, tRNA-specific 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025748.2-542s1c1
Sequence:CCGGGCTCCTAAAGACCTTCTACAACTCGAGTTGTAGAAGGTCTTTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025748.2-261s1c1
Sequence:CCGGGCTGAAATGGTGGCCATTGATCTCGAGATCAATGGCCACCATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025748.2-215s1c1
Sequence:CCGGGAAGGGAACAAATGAAGTGAACTCGAGTTCACTTCATTTGTTCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025748.2-483s1c1
Sequence:CCGGCCCAATACTGGAAGACCGTTTCTCGAGAAACGGTCTTCCAGTATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025748.2-551s1c1
Sequence:CCGGGACCTTCTACAAACAGGAGAACTCGAGTTCTCCTGTTTGTAGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025748
VALIDATED
ADAT2 MISSION shRNA Lentiviral Transduction Particles
adenosine deaminase, tRNA-specific 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025748.2-542s1c1
Sequence:CCGGGCTCCTAAAGACCTTCTACAACTCGAGTTGTAGAAGGTCTTTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025748.2-261s1c1
Sequence:CCGGGCTGAAATGGTGGCCATTGATCTCGAGATCAATGGCCACCATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025748.2-215s1c1
Sequence:CCGGGAAGGGAACAAATGAAGTGAACTCGAGTTCACTTCATTTGTTCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025748.2-483s1c1
Sequence:CCGGCCCAATACTGGAAGACCGTTTCTCGAGAAACGGTCTTCCAGTATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025748.2-551s1c1
Sequence:CCGGGACCTTCTACAAACAGGAGAACTCGAGTTCTCCTGTTTGTAGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182503
ADAT2 MISSION shRNA Bacterial Glycerol Stock
adenosine deaminase, tRNA-specific 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182503.1-804s1c1
Sequence:CCGGGCTGGTTGTATATGGCTGTCACTCGAGTGACAGCCATATACAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182503.1-888s1c1
Sequence:CCGGTGGGAGACCATTTCAGTGTATCTCGAGATACACTGAAATGGTCTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182503.1-683s1c1
Sequence:CCGGTCCTCGATTGGTGTCGTCAAACTCGAGTTTGACGACACCAATCGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182503.1-842s1c1
Sequence:CCGGGTTGTGGCTCTGTTCTAAATACTCGAGTATTTAGAACAGAGCCACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182503.1-824s1c1
Sequence:CCGGAGAATGAACGATTTGGTGGTTCTCGAGAACCACCAAATCGTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182503.2-312s21c1
Sequence:CCGGAGAGTCCCTCTGAAGTATTTGCTCGAGCAAATACTTCAGAGGGACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182503.2-688s21c1
Sequence:CCGGGTTGACATCGTTGAATCATATCTCGAGATATGATTCAACGATGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182503.2-353s21c1
Sequence:CCGGACTGTGGAGCCGTGCATTATGCTCGAGCATAATGCACGGCTCCACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182503.2-795s21c1
Sequence:CCGGCTGACAATTGTAAACAGTTATCTCGAGATAACTGTTTACAATTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182503
ADAT2 MISSION shRNA shRNA Plasmid DNA
adenosine deaminase, tRNA-specific 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182503.1-804s1c1
Sequence:CCGGGCTGGTTGTATATGGCTGTCACTCGAGTGACAGCCATATACAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182503.1-888s1c1
Sequence:CCGGTGGGAGACCATTTCAGTGTATCTCGAGATACACTGAAATGGTCTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182503.1-683s1c1
Sequence:CCGGTCCTCGATTGGTGTCGTCAAACTCGAGTTTGACGACACCAATCGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182503.1-842s1c1
Sequence:CCGGGTTGTGGCTCTGTTCTAAATACTCGAGTATTTAGAACAGAGCCACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182503.1-824s1c1
Sequence:CCGGAGAATGAACGATTTGGTGGTTCTCGAGAACCACCAAATCGTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182503.2-312s21c1
Sequence:CCGGAGAGTCCCTCTGAAGTATTTGCTCGAGCAAATACTTCAGAGGGACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182503.2-688s21c1
Sequence:CCGGGTTGACATCGTTGAATCATATCTCGAGATATGATTCAACGATGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182503.2-353s21c1
Sequence:CCGGACTGTGGAGCCGTGCATTATGCTCGAGCATAATGCACGGCTCCACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182503.2-795s21c1
Sequence:CCGGCTGACAATTGTAAACAGTTATCTCGAGATAACTGTTTACAATTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182503
ADAT2 MISSION shRNA Lentiviral Transduction Particles
adenosine deaminase, tRNA-specific 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182503.1-804s1c1
Sequence:CCGGGCTGGTTGTATATGGCTGTCACTCGAGTGACAGCCATATACAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182503.1-888s1c1
Sequence:CCGGTGGGAGACCATTTCAGTGTATCTCGAGATACACTGAAATGGTCTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182503.1-683s1c1
Sequence:CCGGTCCTCGATTGGTGTCGTCAAACTCGAGTTTGACGACACCAATCGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182503.1-842s1c1
Sequence:CCGGGTTGTGGCTCTGTTCTAAATACTCGAGTATTTAGAACAGAGCCACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182503.1-824s1c1
Sequence:CCGGAGAATGAACGATTTGGTGGTTCTCGAGAACCACCAAATCGTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182503.2-312s21c1
Sequence:CCGGAGAGTCCCTCTGAAGTATTTGCTCGAGCAAATACTTCAGAGGGACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182503.2-688s21c1
Sequence:CCGGGTTGACATCGTTGAATCATATCTCGAGATATGATTCAACGATGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182503.2-353s21c1
Sequence:CCGGACTGTGGAGCCGTGCATTATGCTCGAGCATAATGCACGGCTCCACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182503.2-795s21c1
Sequence:CCGGCTGACAATTGTAAACAGTTATCTCGAGATAACTGTTTACAATTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks