EMAIL THIS PAGE TO A FRIEND

ADAT3

adenosine deaminase, tRNA-specific 3

43 Gene Product Result for
Synonyms: FWP005 MRT36 MST121 MSTP121 S863-5 TAD3
UniProtKB ID: Q96EY9
Gene ID:
Mouse(100113398) adenosine deaminase, tRNA-specific 3
Rat(100125374) adenosine deaminase, tRNA-specific 3
Zebrafish(368634) adenosine deaminase, tRNA-specific 3
cow(101905867) adenosine deaminase, tRNA-specific 3
domestic cat(101099692) adenosine deaminase, tRNA-specific 3
dog(485075) adenosine deaminase, tRNA-specific 3
domestic guinea pig(100735865) adenosine deaminase, tRNA-specific 3
naked mole-rat(101720056) adenosine deaminase, tRNA-specific 3
sheep(101117762) adenosine deaminase, tRNA-specific 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138422 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138422 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138422 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU091181 MISSION® esiRNA esiRNA targeting mouse Adat3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138422 Rosetta Predictions human pricing
NM_001103361 Rosetta Predictions rat pricing
NM_001100606 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138422 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187436 predicted 1123
2 SASI_Hs01_00187437 predicted 1341
3 SASI_Hs01_00187438 predicted 897
4 SASI_Hs01_00187439 predicted 1126
5 SASI_Hs01_00187440 predicted 391
6 SASI_Hs01_00187441 predicted 1331
7 SASI_Hs01_00187442 predicted 388
8 SASI_Hs01_00187443 predicted 939
9 SASI_Hs01_00187444 predicted 1346
10 SASI_Hs01_00187445 predicted 1351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001103361 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211596 predicted 845
2 SASI_Rn02_00211597 predicted 918
3 SASI_Rn02_00211598 predicted 1075
4 SASI_Rn02_00211599 predicted 848
5 SASI_Rn02_00211600 predicted 852
6 SASI_Rn02_00211601 predicted 918
7 SASI_Rn02_00211602 predicted 661
8 SASI_Rn02_00211603 predicted 490
9 SASI_Rn02_00211604 predicted 288
10 SASI_Rn02_00211605 predicted 697
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100606 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302284 predicted 906
2 SASI_Mm02_00302285 predicted 263
3 SASI_Mm02_00302286 predicted 701
4 SASI_Mm02_00302287 predicted 525
5 SASI_Mm02_00302288 predicted 749
6 SASI_Mm02_00302289 predicted 917
7 SASI_Mm02_00302290 predicted 709
8 SASI_Mm02_00302291 predicted 496
9 SASI_Mm02_00302292 predicted 600
10 SASI_Mm02_00302293 predicted 603
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138422
ADAT3 MISSION shRNA Bacterial Glycerol Stock
adenosine deaminase, tRNA-specific 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138422.1-1351s21c1
Sequence:CCGGGCCTCGATTTCTTCCGCACAACTCGAGTTGTGCGGAAGAAATCGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138422.1-1368s21c1
Sequence:CCGGACAAGCCTGACCGTGGATTTCCTCGAGGAAATCCACGGTCAGGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138422.1-1068s21c1
Sequence:CCGGTGGCTACGACCTGTACGTGACCTCGAGGTCACGTACAGGTCGTAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138422.1-1380s21c1
Sequence:CCGGGTGGATTTCAGGGACACATACCTCGAGGTATGTGTCCCTGAAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138422.1-945s21c1
Sequence:CCGGCACCTACGACTTCAGACCCTTCTCGAGAAGGGTCTGAAGTCGTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138422.1-1206s1c1
Sequence:CCGGGCCCGACCTCAACCACCGCTTCTCGAGAAGCGGTGGTTGAGGTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138422.1-1020s1c1
Sequence:CCGGCGTGCGTAAACTGGACGCAGACTCGAGTCTGCGTCCAGTTTACGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138422.1-1128s1c1
Sequence:CCGGCGCACGCATCCTGCGCGTCTTCTCGAGAAGACGCGCAGGATGCGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138422.1-389s1c1
Sequence:CCGGGCCAGACCTCACGCCTCCTGACTCGAGTCAGGAGGCGTGAGGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138422.1-495s1c1
Sequence:CCGGCCTGGAGATGCTGCTTTGCCTCTCGAGAGGCAAAGCAGCATCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138422
ADAT3 MISSION shRNA shRNA Plasmid DNA
adenosine deaminase, tRNA-specific 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138422.1-1351s21c1
Sequence:CCGGGCCTCGATTTCTTCCGCACAACTCGAGTTGTGCGGAAGAAATCGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138422.1-1368s21c1
Sequence:CCGGACAAGCCTGACCGTGGATTTCCTCGAGGAAATCCACGGTCAGGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138422.1-1068s21c1
Sequence:CCGGTGGCTACGACCTGTACGTGACCTCGAGGTCACGTACAGGTCGTAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138422.1-1380s21c1
Sequence:CCGGGTGGATTTCAGGGACACATACCTCGAGGTATGTGTCCCTGAAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138422.1-945s21c1
Sequence:CCGGCACCTACGACTTCAGACCCTTCTCGAGAAGGGTCTGAAGTCGTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138422.1-1206s1c1
Sequence:CCGGGCCCGACCTCAACCACCGCTTCTCGAGAAGCGGTGGTTGAGGTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138422.1-1020s1c1
Sequence:CCGGCGTGCGTAAACTGGACGCAGACTCGAGTCTGCGTCCAGTTTACGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138422.1-1128s1c1
Sequence:CCGGCGCACGCATCCTGCGCGTCTTCTCGAGAAGACGCGCAGGATGCGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138422.1-389s1c1
Sequence:CCGGGCCAGACCTCACGCCTCCTGACTCGAGTCAGGAGGCGTGAGGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138422.1-495s1c1
Sequence:CCGGCCTGGAGATGCTGCTTTGCCTCTCGAGAGGCAAAGCAGCATCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138422
ADAT3 MISSION shRNA Lentiviral Transduction Particles
adenosine deaminase, tRNA-specific 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138422.1-1351s21c1
Sequence:CCGGGCCTCGATTTCTTCCGCACAACTCGAGTTGTGCGGAAGAAATCGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138422.1-1368s21c1
Sequence:CCGGACAAGCCTGACCGTGGATTTCCTCGAGGAAATCCACGGTCAGGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138422.1-1068s21c1
Sequence:CCGGTGGCTACGACCTGTACGTGACCTCGAGGTCACGTACAGGTCGTAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138422.1-1380s21c1
Sequence:CCGGGTGGATTTCAGGGACACATACCTCGAGGTATGTGTCCCTGAAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138422.1-945s21c1
Sequence:CCGGCACCTACGACTTCAGACCCTTCTCGAGAAGGGTCTGAAGTCGTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138422.1-1206s1c1
Sequence:CCGGGCCCGACCTCAACCACCGCTTCTCGAGAAGCGGTGGTTGAGGTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138422.1-1020s1c1
Sequence:CCGGCGTGCGTAAACTGGACGCAGACTCGAGTCTGCGTCCAGTTTACGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138422.1-1128s1c1
Sequence:CCGGCGCACGCATCCTGCGCGTCTTCTCGAGAAGACGCGCAGGATGCGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138422.1-389s1c1
Sequence:CCGGGCCAGACCTCACGCCTCCTGACTCGAGTCAGGAGGCGTGAGGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138422.1-495s1c1
Sequence:CCGGCCTGGAGATGCTGCTTTGCCTCTCGAGAGGCAAAGCAGCATCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks