EMAIL THIS PAGE TO A FRIEND

ADC

arginine decarboxylase

187 Gene Product Result for
Synonyms: AZI2 ODC-p ODC1L
Gene ID:
Mouse(242669) arginine decarboxylase
Rat(366473) arginine decarboxylase
chicken(428228) arginine decarboxylase
cow(506961) arginine decarboxylase
Horse(100070043) arginine decarboxylase
dog(478144) arginine decarboxylase
domestic cat(101081650) arginine decarboxylase
naked mole-rat(101698492) arginine decarboxylase
domestic guinea pig(100713471) arginine decarboxylase
sheep(101110393) arginine decarboxylase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172875 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172875 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172875 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052998 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052998 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052998 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052998 Rosetta Predictions human pricing
NM_001014261 Rosetta Predictions rat pricing
XM_001060961 Rosetta Predictions rat pricing
NM_172875 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052998 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034845 predicted 1085
2 SASI_Hs01_00034846 predicted 842
3 SASI_Hs01_00034847 predicted 1337
4 SASI_Hs01_00034848 predicted 1260
5 SASI_Hs01_00034849 predicted 926
6 SASI_Hs01_00034850 predicted 1462
7 SASI_Hs01_00034851 predicted 932
8 SASI_Hs01_00034852 predicted 942
9 SASI_Hs01_00034853 predicted 926
10 SASI_Hs01_00034854 predicted 1029
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014261 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036893 predicted 956
2 SASI_Rn01_00036894 predicted 1084
3 SASI_Rn01_00036895 predicted 1306
4 SASI_Rn01_00036896 predicted 1235
5 SASI_Rn01_00036897 predicted 1252
6 SASI_Rn02_00201830 predicted 1442
7 SASI_Rn01_00036898 predicted 679
8 SASI_Rn01_00036899 predicted 494
9 SASI_Rn01_00036900 predicted 597
10 SASI_Rn01_00036901 predicted 535
11 SASI_Rn01_00036902 predicted 434
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060961 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00298292 predicted 308
2 SASI_Rn02_00298293 predicted 320
3 SASI_Rn02_00298294 predicted 337
4 SASI_Rn02_00298295 predicted 314
5 SASI_Rn02_00298296 predicted 339
6 SASI_Rn02_00298297 predicted 233
7 SASI_Rn02_00298298 predicted 332
8 SASI_Rn02_00298299 predicted 224
9 SASI_Rn02_00298300 predicted 341
10 SASI_Rn02_00298301 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172875 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166791 predicted 956
2 SASI_Mm01_00166792 predicted 1662
3 SASI_Mm01_00166793 predicted 351
4 SASI_Mm01_00166794 predicted 1487
5 SASI_Mm01_00166795 predicted 461
6 SASI_Mm01_00166796 predicted 1484
7 SASI_Mm01_00166797 predicted 467
8 SASI_Mm01_00166798 predicted 809
9 SASI_Mm01_00166799 predicted 966
10 SASI_Mm01_00166800 predicted 1348
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172875
ADC MISSION shRNA Bacterial Glycerol Stock
arginine decarboxylase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172875.1-1260s1c1
Sequence:CCGGCCCTAAGAGCATCGTGTACTACTCGAGTAGTACACGATGCTCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172875.1-1277s1c1
Sequence:CCGGACTACCTTGATGAGGGCGTTTCTCGAGAAACGCCCTCATCAAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172875.1-970s1c1
Sequence:CCGGGCGGATGCTAGGCTGGTGTTTCTCGAGAAACACCAGCCTAGCATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172875.1-1048s1c1
Sequence:CCGGCCTGGCTTAGAGGGAGCCAAACTCGAGTTTGGCTCCCTCTAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172875.1-648s1c1
Sequence:CCGGCAGTAAGATCATCTGTGCCAACTCGAGTTGGCACAGATGATCTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172875
ADC MISSION shRNA shRNA Plasmid DNA
arginine decarboxylase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172875.1-1260s1c1
Sequence:CCGGCCCTAAGAGCATCGTGTACTACTCGAGTAGTACACGATGCTCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172875.1-1277s1c1
Sequence:CCGGACTACCTTGATGAGGGCGTTTCTCGAGAAACGCCCTCATCAAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172875.1-970s1c1
Sequence:CCGGGCGGATGCTAGGCTGGTGTTTCTCGAGAAACACCAGCCTAGCATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172875.1-1048s1c1
Sequence:CCGGCCTGGCTTAGAGGGAGCCAAACTCGAGTTTGGCTCCCTCTAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172875.1-648s1c1
Sequence:CCGGCAGTAAGATCATCTGTGCCAACTCGAGTTGGCACAGATGATCTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172875
ADC MISSION shRNA Lentiviral Transduction Particles
arginine decarboxylase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172875.1-1260s1c1
Sequence:CCGGCCCTAAGAGCATCGTGTACTACTCGAGTAGTACACGATGCTCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172875.1-1277s1c1
Sequence:CCGGACTACCTTGATGAGGGCGTTTCTCGAGAAACGCCCTCATCAAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172875.1-970s1c1
Sequence:CCGGGCGGATGCTAGGCTGGTGTTTCTCGAGAAACACCAGCCTAGCATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172875.1-1048s1c1
Sequence:CCGGCCTGGCTTAGAGGGAGCCAAACTCGAGTTTGGCTCCCTCTAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172875.1-648s1c1
Sequence:CCGGCAGTAAGATCATCTGTGCCAACTCGAGTTGGCACAGATGATCTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052998
VALIDATED
ADC MISSION shRNA Bacterial Glycerol Stock
arginine decarboxylase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052998.2-2005s1c1
Sequence:CCGGGCCTCAGAGATGCATCTGGGACTCGAGTCCCAGATGCATCTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_052998.2-1527s1c1
Sequence:CCGGACCATCGTGTACCACCTTGATCTCGAGATCAAGGTGGTACACGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_052998.2-929s1c1
Sequence:CCGGCTGTAAGCAAATTGCACAGATCTCGAGATCTGTGCAATTTGCTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052998.2-729s1c1
Sequence:CCGGGCCATAGTGAGGAAGCACTTTCTCGAGAAAGTGCTTCCTCACTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052998.2-980s1c1
Sequence:CCGGGCTGAGCTTTGACAATGAGATCTCGAGATCTCATTGTCAAAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052998.2-935s21c1
Sequence:CCGGGCAAATTGCACAGATCAAATACTCGAGTATTTGATCTGTGCAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052998.2-980s21c1
Sequence:CCGGGCTGAGCTTTGACAATGAGATCTCGAGATCTCATTGTCAAAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052998.2-2005s21c1
Sequence:CCGGGCCTCAGAGATGCATCTGGGACTCGAGTCCCAGATGCATCTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052998.2-1527s21c1
Sequence:CCGGACCATCGTGTACCACCTTGATCTCGAGATCAAGGTGGTACACGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052998
VALIDATED
ADC MISSION shRNA shRNA Plasmid DNA
arginine decarboxylase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052998.2-2005s1c1
Sequence:CCGGGCCTCAGAGATGCATCTGGGACTCGAGTCCCAGATGCATCTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_052998.2-1527s1c1
Sequence:CCGGACCATCGTGTACCACCTTGATCTCGAGATCAAGGTGGTACACGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_052998.2-929s1c1
Sequence:CCGGCTGTAAGCAAATTGCACAGATCTCGAGATCTGTGCAATTTGCTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052998.2-729s1c1
Sequence:CCGGGCCATAGTGAGGAAGCACTTTCTCGAGAAAGTGCTTCCTCACTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052998.2-980s1c1
Sequence:CCGGGCTGAGCTTTGACAATGAGATCTCGAGATCTCATTGTCAAAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052998.2-935s21c1
Sequence:CCGGGCAAATTGCACAGATCAAATACTCGAGTATTTGATCTGTGCAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052998.2-980s21c1
Sequence:CCGGGCTGAGCTTTGACAATGAGATCTCGAGATCTCATTGTCAAAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052998.2-2005s21c1
Sequence:CCGGGCCTCAGAGATGCATCTGGGACTCGAGTCCCAGATGCATCTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052998.2-1527s21c1
Sequence:CCGGACCATCGTGTACCACCTTGATCTCGAGATCAAGGTGGTACACGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052998
VALIDATED
ADC MISSION shRNA Lentiviral Transduction Particles
arginine decarboxylase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052998.2-2005s1c1
Sequence:CCGGGCCTCAGAGATGCATCTGGGACTCGAGTCCCAGATGCATCTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_052998.2-1527s1c1
Sequence:CCGGACCATCGTGTACCACCTTGATCTCGAGATCAAGGTGGTACACGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_052998.2-929s1c1
Sequence:CCGGCTGTAAGCAAATTGCACAGATCTCGAGATCTGTGCAATTTGCTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052998.2-729s1c1
Sequence:CCGGGCCATAGTGAGGAAGCACTTTCTCGAGAAAGTGCTTCCTCACTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052998.2-980s1c1
Sequence:CCGGGCTGAGCTTTGACAATGAGATCTCGAGATCTCATTGTCAAAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052998.2-935s21c1
Sequence:CCGGGCAAATTGCACAGATCAAATACTCGAGTATTTGATCTGTGCAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052998.2-980s21c1
Sequence:CCGGGCTGAGCTTTGACAATGAGATCTCGAGATCTCATTGTCAAAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052998.2-2005s21c1
Sequence:CCGGGCCTCAGAGATGCATCTGGGACTCGAGTCCCAGATGCATCTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052998.2-1527s21c1
Sequence:CCGGACCATCGTGTACCACCTTGATCTCGAGATCAAGGTGGTACACGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks