EMAIL THIS PAGE TO A FRIEND

ADCK2

aarF domain containing kinase 2

62 Gene Product Result for
Synonyms: AARF
UniProtKB ID: Q7Z695, Q96CN6, Q9Y6T5
Gene ID:
Mouse(57869) aarF domain containing kinase 2
Rat(312258) aarF domain containing kinase 2
naked mole-rat(101709746) aarF domain containing kinase 2
domestic guinea pig(100718052) aarF domain containing kinase 2
sheep(101106933) aarF domain containing kinase 2
Domestic Rabbit(100351708) aarF domain containing kinase 2
chicken(418116) aarF domain containing kinase 2
dog(475527) aarF domain containing kinase 2
Horse(100065809) aarF domain containing kinase 2
cow(539345) aarF domain containing kinase 2
domestic cat(101082139) aarF domain containing kinase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178873 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178873 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178873 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052853 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052853 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052853 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052853 Rosetta Predictions human pricing
NM_001107855 Rosetta Predictions rat pricing
NM_178873 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052853 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138134 predicted 1476
2 SASI_Hs01_00138135 predicted 1409
3 SASI_Hs01_00138136 predicted 1294
4 SASI_Hs01_00138138 predicted 928
5 SASI_Hs01_00138139 predicted 1008
6 SASI_Hs01_00138140 predicted 1367
7 SASI_Hs01_00138141 predicted 1902
8 SASI_Hs01_00138142 predicted 1400
9 SASI_Hs01_00138143 predicted 1081
10 SASI_Hs02_00361548 predicted 1196
11 SASI_Hs01_00138137 predicted 1496
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107855 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232945 predicted 1676
2 SASI_Rn02_00232946 predicted 1026
3 SASI_Rn02_00232947 predicted 1470
4 SASI_Rn02_00232948 predicted 1042
5 SASI_Rn02_00232949 predicted 1386
6 SASI_Rn02_00232950 predicted 537
7 SASI_Rn02_00232951 predicted 1685
8 SASI_Rn02_00232952 predicted 1554
9 SASI_Rn02_00232953 predicted 445
10 SASI_Rn02_00232954 predicted 1466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178873 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054686 predicted 1699
2 SASI_Mm01_00054687 predicted 1043
3 SASI_Mm01_00054688 predicted 1703
4 SASI_Mm01_00054689 predicted 1056
5 SASI_Mm01_00054690 predicted 553
6 SASI_Mm01_00054691 predicted 1578
7 SASI_Mm01_00054692 predicted 1079
8 SASI_Mm01_00054693 predicted 2051
9 SASI_Mm01_00054694 predicted 1979
10 SASI_Mm02_00349456 predicted 1160
11 SASI_Mm01_00054695 predicted 1255
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178873
ADCK2 MISSION shRNA Bacterial Glycerol Stock
aarF domain containing kinase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178873.2-1170s1c1
Sequence:CCGGGCCCTTTATGAAAGACCGGAACTCGAGTTCCGGTCTTTCATAAAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178873.2-568s1c1
Sequence:CCGGCCCAAATTAATCTCAGCCCATCTCGAGATGGGCTGAGATTAATTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178873.2-1580s1c1
Sequence:CCGGCTAGGGATATTCTGGTGGAAACTCGAGTTTCCACCAGAATATCCCTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178873.2-2100s1c1
Sequence:CCGGCCTCCTATCCAGTGTCTTTAACTCGAGTTAAAGACACTGGATAGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178873.2-1318s1c1
Sequence:CCGGCCAGTGGCAGTGAAAGTATTACTCGAGTAATACTTTCACTGCCACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178873.3-1570s21c1
Sequence:CCGGCCCTCATCACTAGGGATATTCCTCGAGGAATATCCCTAGTGATGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178873.3-1070s21c1
Sequence:CCGGCAAAGCGTTCGCTAGTATTTCCTCGAGGAAATACTAGCGAACGCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178873.3-2117s21c1
Sequence:CCGGTAAGCTACTGATGACCCATAACTCGAGTTATGGGTCATCAGTAGCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178873.3-735s21c1
Sequence:CCGGGGTGTGCTCTTGGCGAAATTCCTCGAGGAATTTCGCCAAGAGCACACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178873
ADCK2 MISSION shRNA shRNA Plasmid DNA
aarF domain containing kinase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178873.2-1170s1c1
Sequence:CCGGGCCCTTTATGAAAGACCGGAACTCGAGTTCCGGTCTTTCATAAAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178873.2-568s1c1
Sequence:CCGGCCCAAATTAATCTCAGCCCATCTCGAGATGGGCTGAGATTAATTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178873.2-1580s1c1
Sequence:CCGGCTAGGGATATTCTGGTGGAAACTCGAGTTTCCACCAGAATATCCCTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178873.2-2100s1c1
Sequence:CCGGCCTCCTATCCAGTGTCTTTAACTCGAGTTAAAGACACTGGATAGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178873.2-1318s1c1
Sequence:CCGGCCAGTGGCAGTGAAAGTATTACTCGAGTAATACTTTCACTGCCACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178873.3-1570s21c1
Sequence:CCGGCCCTCATCACTAGGGATATTCCTCGAGGAATATCCCTAGTGATGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178873.3-1070s21c1
Sequence:CCGGCAAAGCGTTCGCTAGTATTTCCTCGAGGAAATACTAGCGAACGCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178873.3-2117s21c1
Sequence:CCGGTAAGCTACTGATGACCCATAACTCGAGTTATGGGTCATCAGTAGCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178873.3-735s21c1
Sequence:CCGGGGTGTGCTCTTGGCGAAATTCCTCGAGGAATTTCGCCAAGAGCACACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178873
ADCK2 MISSION shRNA Lentiviral Transduction Particles
aarF domain containing kinase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178873.2-1170s1c1
Sequence:CCGGGCCCTTTATGAAAGACCGGAACTCGAGTTCCGGTCTTTCATAAAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178873.2-568s1c1
Sequence:CCGGCCCAAATTAATCTCAGCCCATCTCGAGATGGGCTGAGATTAATTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178873.2-1580s1c1
Sequence:CCGGCTAGGGATATTCTGGTGGAAACTCGAGTTTCCACCAGAATATCCCTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178873.2-2100s1c1
Sequence:CCGGCCTCCTATCCAGTGTCTTTAACTCGAGTTAAAGACACTGGATAGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178873.2-1318s1c1
Sequence:CCGGCCAGTGGCAGTGAAAGTATTACTCGAGTAATACTTTCACTGCCACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178873.3-1570s21c1
Sequence:CCGGCCCTCATCACTAGGGATATTCCTCGAGGAATATCCCTAGTGATGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178873.3-1070s21c1
Sequence:CCGGCAAAGCGTTCGCTAGTATTTCCTCGAGGAAATACTAGCGAACGCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178873.3-2117s21c1
Sequence:CCGGTAAGCTACTGATGACCCATAACTCGAGTTATGGGTCATCAGTAGCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178873.3-735s21c1
Sequence:CCGGGGTGTGCTCTTGGCGAAATTCCTCGAGGAATTTCGCCAAGAGCACACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052853
VALIDATED
ADCK2 MISSION shRNA Bacterial Glycerol Stock
aarF domain containing kinase 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052853.3-1019s1c1
Sequence:CCGGGCTGACCTGGTTGGATCAAATCTCGAGATTTGATCCAACCAGGTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052853.3-1748s1c1
Sequence:CCGGGCTGAGCTGATCCTGCATCATCTCGAGATGATGCAGGATCAGCTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052853.3-490s1c1
Sequence:CCGGCGCTCTGTTGGTGAAATTCTTCTCGAGAAGAATTTCACCAACAGAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021394    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052853.3-2204s1c1
Sequence:CCGGTGCTTGGTTTGAGGGTCTGTTCTCGAGAACAGACCCTCAAACCAAGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199698    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052853.3-2106s1c1
Sequence:CCGGCCCAAGAGCCTCTCCTATGGCCTCGAGGCCATAGGAGAGGCTCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052853.3-1289s1c1
Sequence:CCGGGAACACTTCCAGGTCAACTTCCTCGAGGAAGTTGACCTGGAAGTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052853.3-223s1c1
Sequence:CCGGCCTGAGGTGCTTCGAGCTCAGCTCGAGCTGAGCTCGAAGCACCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052853.3-1878s1c1
Sequence:CCGGGCCTTCTCTCTAGTGTCTTTACTCGAGTAAAGACACTAGAGAGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052853
VALIDATED
ADCK2 MISSION shRNA shRNA Plasmid DNA
aarF domain containing kinase 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052853.3-1019s1c1
Sequence:CCGGGCTGACCTGGTTGGATCAAATCTCGAGATTTGATCCAACCAGGTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052853.3-1748s1c1
Sequence:CCGGGCTGAGCTGATCCTGCATCATCTCGAGATGATGCAGGATCAGCTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052853.3-490s1c1
Sequence:CCGGCGCTCTGTTGGTGAAATTCTTCTCGAGAAGAATTTCACCAACAGAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021394    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052853.3-2204s1c1
Sequence:CCGGTGCTTGGTTTGAGGGTCTGTTCTCGAGAACAGACCCTCAAACCAAGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199698    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052853.3-2106s1c1
Sequence:CCGGCCCAAGAGCCTCTCCTATGGCCTCGAGGCCATAGGAGAGGCTCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052853.3-1289s1c1
Sequence:CCGGGAACACTTCCAGGTCAACTTCCTCGAGGAAGTTGACCTGGAAGTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052853.3-223s1c1
Sequence:CCGGCCTGAGGTGCTTCGAGCTCAGCTCGAGCTGAGCTCGAAGCACCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052853.3-1878s1c1
Sequence:CCGGGCCTTCTCTCTAGTGTCTTTACTCGAGTAAAGACACTAGAGAGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052853
VALIDATED
ADCK2 MISSION shRNA Lentiviral Transduction Particles
aarF domain containing kinase 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052853.3-1019s1c1
Sequence:CCGGGCTGACCTGGTTGGATCAAATCTCGAGATTTGATCCAACCAGGTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052853.3-1748s1c1
Sequence:CCGGGCTGAGCTGATCCTGCATCATCTCGAGATGATGCAGGATCAGCTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052853.3-490s1c1
Sequence:CCGGCGCTCTGTTGGTGAAATTCTTCTCGAGAAGAATTTCACCAACAGAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021394    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052853.3-2204s1c1
Sequence:CCGGTGCTTGGTTTGAGGGTCTGTTCTCGAGAACAGACCCTCAAACCAAGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199698    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052853.3-2106s1c1
Sequence:CCGGCCCAAGAGCCTCTCCTATGGCCTCGAGGCCATAGGAGAGGCTCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052853.3-1289s1c1
Sequence:CCGGGAACACTTCCAGGTCAACTTCCTCGAGGAAGTTGACCTGGAAGTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052853.3-223s1c1
Sequence:CCGGCCTGAGGTGCTTCGAGCTCAGCTCGAGCTGAGCTCGAAGCACCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052853.3-1878s1c1
Sequence:CCGGGCCTTCTCTCTAGTGTCTTTACTCGAGTAAAGACACTAGAGAGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)