EMAIL THIS PAGE TO A FRIEND

ADCK3

aarF domain containing kinase 3

66 Gene Product Result for
Synonyms: ARCA2 CABC1 COQ10D4 COQ8 SCAR9
UniProtKB ID: Q8NI60, Q5T7A5, Q63HK0, Q8NCJ6, Q9HBQ1, Q9NQ67
Gene ID:
Human(56997) Summary: This gene encodes a mitochondrial protein similar to yeast ABC1, which functions in an electron-transferring membrane protein complex in the respiratory chain. It is not related to the family of ABC transporter proteins. Expression of this gene is induced by the tumor suppressor p53 and in response to DNA damage, and inhibiting its expression partially suppresses p53-induced apoptosis. Alternatively spliced transcript variants have been found; however, their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(67426) aarF domain containing kinase 3
Rat(360887) aarF domain containing kinase 3
Zebrafish(437001) aarF domain containing kinase 3
cow(536925) aarF domain containing kinase 3
domestic cat(101087805) aarF domain containing kinase 3
dog(480108) aarF domain containing kinase 3
chicken(416745) aarF domain containing kinase 3
sheep(101114037) aarF domain containing kinase 3
domestic guinea pig(100728070) aarF domain containing kinase 3
naked mole-rat(101718581) aarF domain containing kinase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020247 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020247 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020247 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023341 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023341 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023341 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020247 Rosetta Predictions human pricing
NM_001013185 Rosetta Predictions rat pricing
NM_023341 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020247 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107693 predicted 1569
2 SASI_Hs01_00107694 predicted 1700
3 SASI_Hs02_00353201 predicted 2287
4 SASI_Hs01_00107695 predicted 1457
5 SASI_Hs01_00107698 predicted 347
6 SASI_Hs01_00107699 predicted 2364
7 SASI_Hs01_00107700 predicted 992
8 SASI_Hs01_00107701 predicted 1934
9 SASI_Hs01_00107702 predicted 2352
10 SASI_Hs02_00353202 predicted 1979
11 SASI_Hs01_00107696 predicted 1871
12 SASI_Hs01_00107697 predicted 1976
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013185 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101644 predicted 1760
2 SASI_Rn01_00101645 predicted 210
3 SASI_Rn01_00101646 predicted 1132
4 SASI_Rn01_00101647 predicted 453
5 SASI_Rn01_00101648 predicted 1322
6 SASI_Rn01_00101649 predicted 231
7 SASI_Rn01_00101650 predicted 1783
8 SASI_Rn01_00101651 predicted 1924
9 SASI_Rn01_00101652 predicted 1573
10 SASI_Rn02_00200945 predicted 760
11 SASI_Rn01_00101653 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023341 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087046 predicted 322
2 SASI_Mm01_00087047 predicted 1664
3 SASI_Mm01_00087048 predicted 1233
4 SASI_Mm01_00087049 predicted 341
5 SASI_Mm01_00087050 predicted 853
6 SASI_Mm01_00087051 predicted 1680
7 SASI_Mm01_00087052 predicted 1983
8 SASI_Mm01_00087053 predicted 1746
9 SASI_Mm01_00087054 predicted 1674
10 SASI_Mm01_00087055 predicted 908
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020247
VALIDATED
ADCK3 MISSION shRNA Bacterial Glycerol Stock
aarF domain containing kinase 3
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020247.4-1290s21c1
Sequence:GTACCGGACAACCTCATGGCCGTGTTGACTCGAGTCAACACGGCCATGAGGTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020247.4-1141s21c1
Sequence:CCGGCTGGCGGGACAAGTTGGAATACTCGAGTATTCCAACTTGTCCCGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020247.4-1722s21c1
Sequence:CCGGCCTTCACCGACCTCTACATTCCTCGAGGAATGTAGAGGTCGGTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020247.4-735s21c1
Sequence:CCGGCCGAGAACAAGCAGCACAAACCTCGAGGTTTGTGCTGCTTGTTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315428    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020247.4-2263s21c1
Sequence:CCGGCCACGGTTTCTGTTGCTAAATCTCGAGATTTAGCAACAGAAACCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020247.4-1018s21c1
Sequence:CCGGCATCCAGGATGATGCCTTTATCTCGAGATAAAGGCATCATCCTGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020247.4-1564s21c1
Sequence:GTACCGGGAACGAGATCTGCTACAACATCTCGAGATGTTGTAGCAGATCTCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020247.4-340s21c1
Sequence:GTACCGGGAAGGTGCAGGGTCAGGATAACTCGAGTTATCCTGACCCTGCACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020247.4-1082s1c1
Sequence:CCGGGCGGACTTCATGCCACTGAAGCTCGAGCTTCAGTGGCATGAAGTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199375    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020247.4-2341s1c1
Sequence:CCGGCCTCCGTGTGTCCTCTGAAATCTCGAGATTTCAGAGGACACACGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020247.4-1788s1c1
Sequence:CCGGCGAAATCCATAGAGATGAAGTCTCGAGACTTCATCTCTATGGATTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020247.3-2212s1c1
Sequence:CCGGCCACGGTTTCTGTTGCTAAATCTCGAGATTTAGCAACAGAAACCGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020247.3-1093s1c1
Sequence:CCGGGCGGGACAAGTTGGAATACTTCTCGAGAAGTATTCCAACTTGTCCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020247.3-966s1c1
Sequence:CCGGGCATCCAGGATGATGCCTTTACTCGAGTAAAGGCATCATCCTGGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020247.3-683s1c1
Sequence:CCGGCCCGAGAACAAGCAGCACAAACTCGAGTTTGTGCTGCTTGTTCTCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020247
VALIDATED
ADCK3 MISSION shRNA shRNA Plasmid DNA
aarF domain containing kinase 3
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020247.4-1290s21c1
Sequence:GTACCGGACAACCTCATGGCCGTGTTGACTCGAGTCAACACGGCCATGAGGTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020247.4-1141s21c1
Sequence:CCGGCTGGCGGGACAAGTTGGAATACTCGAGTATTCCAACTTGTCCCGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020247.4-1722s21c1
Sequence:CCGGCCTTCACCGACCTCTACATTCCTCGAGGAATGTAGAGGTCGGTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020247.4-735s21c1
Sequence:CCGGCCGAGAACAAGCAGCACAAACCTCGAGGTTTGTGCTGCTTGTTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315428    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020247.4-2263s21c1
Sequence:CCGGCCACGGTTTCTGTTGCTAAATCTCGAGATTTAGCAACAGAAACCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020247.4-1018s21c1
Sequence:CCGGCATCCAGGATGATGCCTTTATCTCGAGATAAAGGCATCATCCTGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020247.4-1564s21c1
Sequence:GTACCGGGAACGAGATCTGCTACAACATCTCGAGATGTTGTAGCAGATCTCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020247.4-340s21c1
Sequence:GTACCGGGAAGGTGCAGGGTCAGGATAACTCGAGTTATCCTGACCCTGCACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020247.4-1082s1c1
Sequence:CCGGGCGGACTTCATGCCACTGAAGCTCGAGCTTCAGTGGCATGAAGTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199375    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020247.4-2341s1c1
Sequence:CCGGCCTCCGTGTGTCCTCTGAAATCTCGAGATTTCAGAGGACACACGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020247.4-1788s1c1
Sequence:CCGGCGAAATCCATAGAGATGAAGTCTCGAGACTTCATCTCTATGGATTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020247.3-2212s1c1
Sequence:CCGGCCACGGTTTCTGTTGCTAAATCTCGAGATTTAGCAACAGAAACCGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020247.3-1093s1c1
Sequence:CCGGGCGGGACAAGTTGGAATACTTCTCGAGAAGTATTCCAACTTGTCCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020247.3-966s1c1
Sequence:CCGGGCATCCAGGATGATGCCTTTACTCGAGTAAAGGCATCATCCTGGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020247.3-683s1c1
Sequence:CCGGCCCGAGAACAAGCAGCACAAACTCGAGTTTGTGCTGCTTGTTCTCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020247
VALIDATED
ADCK3 MISSION shRNA Lentiviral Transduction Particles
aarF domain containing kinase 3
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020247.4-1290s21c1
Sequence:GTACCGGACAACCTCATGGCCGTGTTGACTCGAGTCAACACGGCCATGAGGTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020247.4-1141s21c1
Sequence:CCGGCTGGCGGGACAAGTTGGAATACTCGAGTATTCCAACTTGTCCCGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020247.4-1722s21c1
Sequence:CCGGCCTTCACCGACCTCTACATTCCTCGAGGAATGTAGAGGTCGGTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020247.4-735s21c1
Sequence:CCGGCCGAGAACAAGCAGCACAAACCTCGAGGTTTGTGCTGCTTGTTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315428    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020247.4-2263s21c1
Sequence:CCGGCCACGGTTTCTGTTGCTAAATCTCGAGATTTAGCAACAGAAACCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020247.4-1018s21c1
Sequence:CCGGCATCCAGGATGATGCCTTTATCTCGAGATAAAGGCATCATCCTGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020247.4-1564s21c1
Sequence:GTACCGGGAACGAGATCTGCTACAACATCTCGAGATGTTGTAGCAGATCTCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020247.4-340s21c1
Sequence:GTACCGGGAAGGTGCAGGGTCAGGATAACTCGAGTTATCCTGACCCTGCACCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020247.4-1082s1c1
Sequence:CCGGGCGGACTTCATGCCACTGAAGCTCGAGCTTCAGTGGCATGAAGTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199375    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020247.4-2341s1c1
Sequence:CCGGCCTCCGTGTGTCCTCTGAAATCTCGAGATTTCAGAGGACACACGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020247.4-1788s1c1
Sequence:CCGGCGAAATCCATAGAGATGAAGTCTCGAGACTTCATCTCTATGGATTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020247.3-2212s1c1
Sequence:CCGGCCACGGTTTCTGTTGCTAAATCTCGAGATTTAGCAACAGAAACCGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020247.3-1093s1c1
Sequence:CCGGGCGGGACAAGTTGGAATACTTCTCGAGAAGTATTCCAACTTGTCCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020247.3-966s1c1
Sequence:CCGGGCATCCAGGATGATGCCTTTACTCGAGTAAAGGCATCATCCTGGATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020247.3-683s1c1
Sequence:CCGGCCCGAGAACAAGCAGCACAAACTCGAGTTTGTGCTGCTTGTTCTCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023341
VALIDATED
ADCK3 MISSION shRNA Bacterial Glycerol Stock
aarF domain containing kinase 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023341.3-1818s21c1
Sequence:CCGGATGCTCACCTGGATGCTATTCCTCGAGGAATAGCATCCAGGTGAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023341.3-1542s21c1
Sequence:CCGGATGAGATCTGCTACAACATTTCTCGAGAAATGTTGTAGCAGATCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023341.3-1778s21c1
Sequence:CCGGATGAAGTTCCTTACCGGTTATCTCGAGATAACCGGTAAGGAACTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023341.3-1474s21c1
Sequence:CCGGGCTGACCACAGAGCTCATATCCTCGAGGATATGAGCTCTGTGGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023341.2-3757s1c1
Sequence:CCGGCCTTAAATAGTTCTGTGCAAACTCGAGTTTGCACAGAACTATTTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023341.2-1574s1c1
Sequence:CCGGGCTGTTTGAGTTCCATGTCATCTCGAGATGACATGGAACTCAAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023341.2-557s1c1
Sequence:CCGGCAGAGTCAATGGAAGGCTCTTCTCGAGAAGAGCCTTCCATTGACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023341.2-1062s1c1
Sequence:CCGGCCACTGAAACAGATGACGAAACTCGAGTTTCGTCATCTGTTTCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023341.2-1746s1c1
Sequence:CCGGGCAGTGCTAAAGAAATCCATACTCGAGTATGGATTTCTTTAGCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023341
VALIDATED
ADCK3 MISSION shRNA shRNA Plasmid DNA
aarF domain containing kinase 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023341.3-1818s21c1
Sequence:CCGGATGCTCACCTGGATGCTATTCCTCGAGGAATAGCATCCAGGTGAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023341.3-1542s21c1
Sequence:CCGGATGAGATCTGCTACAACATTTCTCGAGAAATGTTGTAGCAGATCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023341.3-1778s21c1
Sequence:CCGGATGAAGTTCCTTACCGGTTATCTCGAGATAACCGGTAAGGAACTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023341.3-1474s21c1
Sequence:CCGGGCTGACCACAGAGCTCATATCCTCGAGGATATGAGCTCTGTGGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023341.2-3757s1c1
Sequence:CCGGCCTTAAATAGTTCTGTGCAAACTCGAGTTTGCACAGAACTATTTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023341.2-1574s1c1
Sequence:CCGGGCTGTTTGAGTTCCATGTCATCTCGAGATGACATGGAACTCAAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023341.2-557s1c1
Sequence:CCGGCAGAGTCAATGGAAGGCTCTTCTCGAGAAGAGCCTTCCATTGACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023341.2-1062s1c1
Sequence:CCGGCCACTGAAACAGATGACGAAACTCGAGTTTCGTCATCTGTTTCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023341.2-1746s1c1
Sequence:CCGGGCAGTGCTAAAGAAATCCATACTCGAGTATGGATTTCTTTAGCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023341
VALIDATED
ADCK3 MISSION shRNA Lentiviral Transduction Particles
aarF domain containing kinase 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023341.3-1818s21c1
Sequence:CCGGATGCTCACCTGGATGCTATTCCTCGAGGAATAGCATCCAGGTGAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023341.3-1542s21c1
Sequence:CCGGATGAGATCTGCTACAACATTTCTCGAGAAATGTTGTAGCAGATCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023341.3-1778s21c1
Sequence:CCGGATGAAGTTCCTTACCGGTTATCTCGAGATAACCGGTAAGGAACTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023341.3-1474s21c1
Sequence:CCGGGCTGACCACAGAGCTCATATCCTCGAGGATATGAGCTCTGTGGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023341.2-3757s1c1
Sequence:CCGGCCTTAAATAGTTCTGTGCAAACTCGAGTTTGCACAGAACTATTTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023341.2-1574s1c1
Sequence:CCGGGCTGTTTGAGTTCCATGTCATCTCGAGATGACATGGAACTCAAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023341.2-557s1c1
Sequence:CCGGCAGAGTCAATGGAAGGCTCTTCTCGAGAAGAGCCTTCCATTGACTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023341.2-1062s1c1
Sequence:CCGGCCACTGAAACAGATGACGAAACTCGAGTTTCGTCATCTGTTTCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023341.2-1746s1c1
Sequence:CCGGGCAGTGCTAAAGAAATCCATACTCGAGTATGGATTTCTTTAGCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)