EMAIL THIS PAGE TO A FRIEND

ADCK4

aarF domain containing kinase 4

107 Gene Product Result for
UniProtKB ID: Q96D53, Q8TAJ1, Q9HA52
Gene ID:
Human(79934) Summary: This gene encodes a protein with two copies of a domain found in protein kinases. The encoded protein has a complete protein kinase catalytic domain, and a truncated domain that contains only the active and binding sites of the protein kinase domain, however, it is not known whether the protein has any kinase activity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Mouse(76889) aarF domain containing kinase 4
Rat(308453) aarF domain containing kinase 4
naked mole-rat(101703397) aarF domain containing kinase 4
domestic guinea pig(100725341) aarF domain containing kinase 4
sheep(101120265) aarF domain containing kinase 4
Domestic Rabbit(100338698) aarF domain containing kinase 4
Zebrafish(799071) aarF domain containing kinase 4
dog(484498) aarF domain containing kinase 4
domestic cat(101091064) aarF domain containing kinase 4
Horse(100068218) aarF domain containing kinase 4
cow(514322) aarF domain containing kinase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133770 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133770 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133770 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024876 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024876 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024876 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024876 Rosetta Predictions human pricing
NM_001012065 Rosetta Predictions rat pricing
XM_001077748 Rosetta Predictions rat pricing
XM_574399 Rosetta Predictions rat pricing
NM_133770 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024876 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174259 predicted 365
2 SASI_Hs01_00174260 predicted 1558
3 SASI_Hs01_00174261 predicted 372
4 SASI_Hs01_00174262 predicted 839
5 SASI_Hs01_00174263 predicted 516
6 SASI_Hs01_00174264 predicted 1386
7 SASI_Hs01_00174265 predicted 1169
8 SASI_Hs01_00174266 predicted 830
9 SASI_Hs01_00174267 predicted 540
10 SASI_Hs01_00174268 predicted 674
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012065 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092825 predicted 1836
2 SASI_Rn01_00092826 predicted 1786
3 SASI_Rn02_00200172 predicted 1245
4 SASI_Rn01_00092827 predicted 1315
5 SASI_Rn01_00092828 predicted 1134
6 SASI_Rn01_00092829 predicted 1788
7 SASI_Rn01_00092830 predicted 1130
8 SASI_Rn01_00092832 predicted 1852
9 SASI_Rn01_00092833 predicted 1245
10 SASI_Rn02_00200173 predicted 1324
11 SASI_Rn01_00092824 predicted 1801
12 SASI_Rn01_00092831 predicted 1805
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077748 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00358341 predicted 746
2 SASI_Rn02_00358342 predicted 826
3 SASI_Rn02_00358343 predicted 1913
4 SASI_Rn02_00358344 predicted 1849
5 SASI_Rn02_00358345 predicted 1201
6 SASI_Rn02_00358346 predicted 1858
7 SASI_Rn02_00358347 predicted 1203
8 SASI_Rn02_00358348 predicted 1929
9 SASI_Rn02_00358349 predicted 1316
10 SASI_Rn02_00358350 predicted 1401
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574399 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00185516 predicted 1943
2 SASI_Rn01_00185517 predicted 1984
3 SASI_Rn01_00185518 predicted 1928
4 SASI_Rn01_00185519 predicted 1449
5 SASI_Rn01_00185520 predicted 1277
6 SASI_Rn01_00185521 predicted 1926
7 SASI_Rn01_00185522 predicted 1270
8 SASI_Rn01_00185523 predicted 1944
9 SASI_Rn01_00185524 predicted 1993
10 SASI_Rn01_00185525 predicted 1387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133770 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058188 predicted 1793
2 SASI_Mm01_00058189 predicted 1892
3 SASI_Mm02_00338779 predicted 627
4 SASI_Mm02_00338780 predicted 1343
5 SASI_Mm01_00058193 predicted 1861
6 SASI_Mm01_00058194 predicted 1909
7 SASI_Mm01_00058195 predicted 1944
8 SASI_Mm02_00338781 predicted 1435
9 SASI_Mm02_00338782 predicted 1910
10 SASI_Mm02_00338783 predicted 729
11 SASI_Mm01_00058190 predicted 398
12 SASI_Mm01_00058191 predicted 1474
13 SASI_Mm01_00058192 predicted 270
14 SASI_Mm01_00058196 predicted 610
15 SASI_Mm01_00058197 predicted 960
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133770
VALIDATED
ADCK4 MISSION shRNA Bacterial Glycerol Stock
aarF domain containing kinase 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133770.1-968s1c1
Sequence:CCGGGAGATCGAGTTCTACAGAAATCTCGAGATTTCTGTAGAACTCGATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133770.1-747s1c1
Sequence:CCGGCCAAGACATCCGGAATCAGATCTCGAGATCTGATTCCGGATGTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133770.1-1266s1c1
Sequence:CCGGCCAAGATACCTACCACCGCTACTCGAGTAGCGGTGGTAGGTATCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133770.1-295s1c1
Sequence:CCGGTGGCAAATGATGAGAGTTCTACTCGAGTAGAACTCTCATCATTTGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133770.1-997s1c1
Sequence:CCGGCTCAAGTTCCTTACAGGCTTTCTCGAGAAAGCCTGTAAGGAACTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133770.2-1184s21c1
Sequence:CCGGCCAAGACATCCGGAATCAGATCTCGAGATCTGATTCCGGATGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133770.2-732s21c1
Sequence:CCGGTGGCAAATGATGAGAGTTCTACTCGAGTAGAACTCTCATCATTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133770.2-1434s21c1
Sequence:CCGGCTCAAGTTCCTTACAGGCTTTCTCGAGAAAGCCTGTAAGGAACTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133770.2-1853s21c1
Sequence:CCGGTGGTCTCCAGAACCTAGTTTCCTCGAGGAAACTAGGTTCTGGAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133770.2-1405s21c1
Sequence:CCGGGAGATCGAGTTCTACAGAAATCTCGAGATTTCTGTAGAACTCGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133770
VALIDATED
ADCK4 MISSION shRNA shRNA Plasmid DNA
aarF domain containing kinase 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133770.1-968s1c1
Sequence:CCGGGAGATCGAGTTCTACAGAAATCTCGAGATTTCTGTAGAACTCGATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133770.1-747s1c1
Sequence:CCGGCCAAGACATCCGGAATCAGATCTCGAGATCTGATTCCGGATGTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133770.1-1266s1c1
Sequence:CCGGCCAAGATACCTACCACCGCTACTCGAGTAGCGGTGGTAGGTATCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133770.1-295s1c1
Sequence:CCGGTGGCAAATGATGAGAGTTCTACTCGAGTAGAACTCTCATCATTTGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133770.1-997s1c1
Sequence:CCGGCTCAAGTTCCTTACAGGCTTTCTCGAGAAAGCCTGTAAGGAACTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133770.2-1184s21c1
Sequence:CCGGCCAAGACATCCGGAATCAGATCTCGAGATCTGATTCCGGATGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133770.2-732s21c1
Sequence:CCGGTGGCAAATGATGAGAGTTCTACTCGAGTAGAACTCTCATCATTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133770.2-1434s21c1
Sequence:CCGGCTCAAGTTCCTTACAGGCTTTCTCGAGAAAGCCTGTAAGGAACTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133770.2-1853s21c1
Sequence:CCGGTGGTCTCCAGAACCTAGTTTCCTCGAGGAAACTAGGTTCTGGAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133770.2-1405s21c1
Sequence:CCGGGAGATCGAGTTCTACAGAAATCTCGAGATTTCTGTAGAACTCGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133770
VALIDATED
ADCK4 MISSION shRNA Lentiviral Transduction Particles
aarF domain containing kinase 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133770.1-968s1c1
Sequence:CCGGGAGATCGAGTTCTACAGAAATCTCGAGATTTCTGTAGAACTCGATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133770.1-747s1c1
Sequence:CCGGCCAAGACATCCGGAATCAGATCTCGAGATCTGATTCCGGATGTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133770.1-1266s1c1
Sequence:CCGGCCAAGATACCTACCACCGCTACTCGAGTAGCGGTGGTAGGTATCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133770.1-295s1c1
Sequence:CCGGTGGCAAATGATGAGAGTTCTACTCGAGTAGAACTCTCATCATTTGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133770.1-997s1c1
Sequence:CCGGCTCAAGTTCCTTACAGGCTTTCTCGAGAAAGCCTGTAAGGAACTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133770.2-1184s21c1
Sequence:CCGGCCAAGACATCCGGAATCAGATCTCGAGATCTGATTCCGGATGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133770.2-732s21c1
Sequence:CCGGTGGCAAATGATGAGAGTTCTACTCGAGTAGAACTCTCATCATTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133770.2-1434s21c1
Sequence:CCGGCTCAAGTTCCTTACAGGCTTTCTCGAGAAAGCCTGTAAGGAACTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133770.2-1853s21c1
Sequence:CCGGTGGTCTCCAGAACCTAGTTTCCTCGAGGAAACTAGGTTCTGGAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133770.2-1405s21c1
Sequence:CCGGGAGATCGAGTTCTACAGAAATCTCGAGATTTCTGTAGAACTCGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024876
VALIDATED
ADCK4 MISSION shRNA Bacterial Glycerol Stock
aarF domain containing kinase 4
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024876.2-1309s1c1
Sequence:CCGGCCATTACATCGAGGTGGTGAACTCGAGTTCACCACCTCGATGTAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_024876.2-530s1c1
Sequence:CCGGGAGCGGATTGTGCAGACCTTACTCGAGTAAGGTCTGCACAATCCGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_024876.2-1220s1c1
Sequence:CCGGTGGGCCAACTTCCTGTATGATCTCGAGATCATACAGGAAGTTGGCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_024876.2-1392s1c1
Sequence:CCGGCAGGCTTTGAAACCAAGGCATCTCGAGATGCCTTGGTTTCAAAGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_024876.2-2034s1c1
Sequence:CCGGCGTTATGCAGATCAGACTCATCTCGAGATGAGTCTGATCTGCATAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024876.2-753s1c1
Sequence:CCGGCCTTTGCCGCTGCCTCAATTGCTCGAGCAATTGAGGCAGCGGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024876.2-542s1c1
Sequence:CCGGCAGACCTTATGTACAGTTCGACTCGAGTCGAACTGTACATAAGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_024876.2-679s1c1
Sequence:CCGGGCAGATGCTGAGAGTTCTTGACTCGAGTCAAGAACTCTCAGCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_024876.2-844s1c1
Sequence:CCGGCCAGAGCATTCAGAGCGATGTCTCGAGACATCGCTCTGAATGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199317    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_024876.2-1913s1c1
Sequence:CCGGCCCAACTTCGTGCCCTAGATCCTCGAGGATCTAGGGCACGAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024876.3-785s21c1
Sequence:CCGGCATCCAGGACAACAGCTTCATCTCGAGATGAAGCTGTTGTCCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024876.3-1555s21c1
Sequence:CCGGAGAAGTCCAGGGACCTCAAATCTCGAGATTTGAGGTCCCTGGACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024876.3-1321s21c1
Sequence:CCGGAGGACCTGCGGAACCAGATTTCTCGAGAAATCTGGTTCCGCAGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024876.3-1371s21c1
Sequence:CCGGGAGCTGTTTGAGTTCCGATTCCTCGAGGAATCGGAACTCAAACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024876.3-620s21c1
Sequence:CCGGACTGGCCGAGATGGCTAAGAACTCGAGTTCTTAGCCATCTCGGCCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024876
VALIDATED
ADCK4 MISSION shRNA shRNA Plasmid DNA
aarF domain containing kinase 4
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024876.2-1309s1c1
Sequence:CCGGCCATTACATCGAGGTGGTGAACTCGAGTTCACCACCTCGATGTAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_024876.2-530s1c1
Sequence:CCGGGAGCGGATTGTGCAGACCTTACTCGAGTAAGGTCTGCACAATCCGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_024876.2-1220s1c1
Sequence:CCGGTGGGCCAACTTCCTGTATGATCTCGAGATCATACAGGAAGTTGGCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_024876.2-1392s1c1
Sequence:CCGGCAGGCTTTGAAACCAAGGCATCTCGAGATGCCTTGGTTTCAAAGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_024876.2-2034s1c1
Sequence:CCGGCGTTATGCAGATCAGACTCATCTCGAGATGAGTCTGATCTGCATAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024876.2-753s1c1
Sequence:CCGGCCTTTGCCGCTGCCTCAATTGCTCGAGCAATTGAGGCAGCGGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024876.2-542s1c1
Sequence:CCGGCAGACCTTATGTACAGTTCGACTCGAGTCGAACTGTACATAAGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_024876.2-679s1c1
Sequence:CCGGGCAGATGCTGAGAGTTCTTGACTCGAGTCAAGAACTCTCAGCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_024876.2-844s1c1
Sequence:CCGGCCAGAGCATTCAGAGCGATGTCTCGAGACATCGCTCTGAATGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199317    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_024876.2-1913s1c1
Sequence:CCGGCCCAACTTCGTGCCCTAGATCCTCGAGGATCTAGGGCACGAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024876.3-785s21c1
Sequence:CCGGCATCCAGGACAACAGCTTCATCTCGAGATGAAGCTGTTGTCCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024876.3-1555s21c1
Sequence:CCGGAGAAGTCCAGGGACCTCAAATCTCGAGATTTGAGGTCCCTGGACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024876.3-1321s21c1
Sequence:CCGGAGGACCTGCGGAACCAGATTTCTCGAGAAATCTGGTTCCGCAGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024876.3-1371s21c1
Sequence:CCGGGAGCTGTTTGAGTTCCGATTCCTCGAGGAATCGGAACTCAAACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024876.3-620s21c1
Sequence:CCGGACTGGCCGAGATGGCTAAGAACTCGAGTTCTTAGCCATCTCGGCCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024876
VALIDATED
ADCK4 MISSION shRNA Lentiviral Transduction Particles
aarF domain containing kinase 4
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024876.2-1309s1c1
Sequence:CCGGCCATTACATCGAGGTGGTGAACTCGAGTTCACCACCTCGATGTAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_024876.2-530s1c1
Sequence:CCGGGAGCGGATTGTGCAGACCTTACTCGAGTAAGGTCTGCACAATCCGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_024876.2-1220s1c1
Sequence:CCGGTGGGCCAACTTCCTGTATGATCTCGAGATCATACAGGAAGTTGGCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_024876.2-1392s1c1
Sequence:CCGGCAGGCTTTGAAACCAAGGCATCTCGAGATGCCTTGGTTTCAAAGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_024876.2-2034s1c1
Sequence:CCGGCGTTATGCAGATCAGACTCATCTCGAGATGAGTCTGATCTGCATAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024876.2-753s1c1
Sequence:CCGGCCTTTGCCGCTGCCTCAATTGCTCGAGCAATTGAGGCAGCGGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024876.2-542s1c1
Sequence:CCGGCAGACCTTATGTACAGTTCGACTCGAGTCGAACTGTACATAAGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_024876.2-679s1c1
Sequence:CCGGGCAGATGCTGAGAGTTCTTGACTCGAGTCAAGAACTCTCAGCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_024876.2-844s1c1
Sequence:CCGGCCAGAGCATTCAGAGCGATGTCTCGAGACATCGCTCTGAATGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199317    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_024876.2-1913s1c1
Sequence:CCGGCCCAACTTCGTGCCCTAGATCCTCGAGGATCTAGGGCACGAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024876.3-785s21c1
Sequence:CCGGCATCCAGGACAACAGCTTCATCTCGAGATGAAGCTGTTGTCCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024876.3-1555s21c1
Sequence:CCGGAGAAGTCCAGGGACCTCAAATCTCGAGATTTGAGGTCCCTGGACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024876.3-1321s21c1
Sequence:CCGGAGGACCTGCGGAACCAGATTTCTCGAGAAATCTGGTTCCGCAGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024876.3-1371s21c1
Sequence:CCGGGAGCTGTTTGAGTTCCGATTCCTCGAGGAATCGGAACTCAAACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024876.3-620s21c1
Sequence:CCGGACTGGCCGAGATGGCTAAGAACTCGAGTTCTTAGCCATCTCGGCCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks