EMAIL THIS PAGE TO A FRIEND

ADCK5

aarF domain containing kinase 5

79 Gene Product Result for
UniProtKB ID: Q3MIX3, Q5U4P1, Q6P2S4, Q8N5V3
Gene ID:
Mouse(268822) aarF domain containing kinase 5
Rat(362943) aarF domain containing kinase 5
Zebrafish(100001584) aarF domain containing kinase 5
cow(522614) aarF domain containing kinase 5
Horse(100064927) aarF domain containing kinase 5
domestic cat(101096446) aarF domain containing kinase 5
dog(482095) aarF domain containing kinase 5
sheep(101112143) aarF domain containing kinase 5
domestic guinea pig(100714822) aarF domain containing kinase 5
naked mole-rat(101719297) aarF domain containing kinase 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172960 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172960 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172960 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_174922 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174922 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174922 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151951 MISSION® esiRNA esiRNA human ADCK5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174922 Rosetta Predictions human pricing
XM_001075206 Rosetta Predictions rat pricing
XM_343273 Rosetta Predictions rat pricing
NM_172960 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174922 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236361 predicted 1087
2 SASI_Hs01_00236362 predicted 1125
3 SASI_Hs01_00236363 predicted 1142
4 SASI_Hs01_00236364 predicted 1647
5 SASI_Hs01_00236366 predicted 349
6 SASI_Hs01_00236367 predicted 1053
7 SASI_Hs01_00236368 predicted 1009
8 SASI_Hs01_00236369 predicted 1150
9 SASI_Hs01_00236370 predicted 316
10 SASI_Hs02_00368847 predicted 598
11 SASI_Hs01_00236365 predicted 1555
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075206 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00348830 predicted 781
2 SASI_Rn02_00348831 predicted 870
3 SASI_Rn02_00348832 predicted 1691
4 SASI_Rn02_00348833 predicted 1583
5 SASI_Rn02_00348834 predicted 489
6 SASI_Rn02_00348835 predicted 1572
7 SASI_Rn02_00348836 predicted 1592
8 SASI_Rn02_00348837 predicted 377
9 SASI_Rn02_00348838 predicted 377
10 SASI_Rn02_00348839 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343273 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395573 predicted 877
2 SASI_Rn02_00395574 predicted 1694
3 SASI_Rn02_00395575 predicted 1793
4 SASI_Rn02_00395576 predicted 1812
5 SASI_Rn02_00395577 predicted 1577
6 SASI_Rn02_00395578 predicted 491
7 SASI_Rn02_00395579 predicted 1574
8 SASI_Rn02_00395580 predicted 1589
9 SASI_Rn02_00395581 predicted 372
10 SASI_Rn02_00395582 predicted 374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172960 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344994 predicted 419
2 SASI_Mm01_00040152 predicted 793
3 SASI_Mm01_00040154 predicted 989
4 SASI_Mm02_00344995 predicted 1212
5 SASI_Mm02_00344996 predicted 787
6 SASI_Mm02_00344997 predicted 828
7 SASI_Mm02_00344998 predicted 468
8 SASI_Mm02_00344999 predicted 968
9 SASI_Mm02_00345000 predicted 766
10 SASI_Mm02_00345001 predicted 999
11 SASI_Mm01_00040151 predicted 1219
12 SASI_Mm01_00040153 predicted 1347
13 SASI_Mm01_00040155 predicted 1503
14 SASI_Mm01_00040156 predicted 1549
15 SASI_Mm01_00040157 predicted 1330
16 SASI_Mm01_00040158 predicted 781
17 SASI_Mm01_00040159 predicted 1152
18 SASI_Mm01_00040160 predicted 948
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172960
VALIDATED
ADCK5 MISSION shRNA Bacterial Glycerol Stock
aarF domain containing kinase 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172960.3-787s21c1
Sequence:CCGGTGGCACTGATGTAGCTGTAAACTCGAGTTTACAGCTACATCAGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172960.3-1505s21c1
Sequence:CCGGGAACACTTTGATGGCATAATGCTCGAGCATTATGCCATCAAAGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172960.3-422s21c1
Sequence:CCGGGACTACTGGTGGTGCACAAACCTCGAGGTTTGTGCACCACCAGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172960.3-957s21c1
Sequence:CCGGTCGAGAATGAGGGCCGAAATGCTCGAGCATTTCGGCCCTCATTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172960.3-1723s21c1
Sequence:CCGGGGTCCTCTGGGAGGCATTAAACTCGAGTTTAATGCCTCCCAGAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172960.1-796s1c1
Sequence:CCGGGCTGTAAAGGTACAGTACATTCTCGAGAATGTACTGTACCTTTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172960.1-1498s1c1
Sequence:CCGGCGTGAACACTTTGATGGCATACTCGAGTATGCCATCAAAGTGTTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172960.1-999s1c1
Sequence:CCGGGCACTTCCACTATGTTGTTATCTCGAGATAACAACATAGTGGAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172960.1-1335s1c1
Sequence:CCGGCCTGAGGGACAATGCTGCAATCTCGAGATTGCAGCATTGTCCCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172960
VALIDATED
ADCK5 MISSION shRNA shRNA Plasmid DNA
aarF domain containing kinase 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172960.3-787s21c1
Sequence:CCGGTGGCACTGATGTAGCTGTAAACTCGAGTTTACAGCTACATCAGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172960.3-1505s21c1
Sequence:CCGGGAACACTTTGATGGCATAATGCTCGAGCATTATGCCATCAAAGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172960.3-422s21c1
Sequence:CCGGGACTACTGGTGGTGCACAAACCTCGAGGTTTGTGCACCACCAGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172960.3-957s21c1
Sequence:CCGGTCGAGAATGAGGGCCGAAATGCTCGAGCATTTCGGCCCTCATTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172960.3-1723s21c1
Sequence:CCGGGGTCCTCTGGGAGGCATTAAACTCGAGTTTAATGCCTCCCAGAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172960.1-796s1c1
Sequence:CCGGGCTGTAAAGGTACAGTACATTCTCGAGAATGTACTGTACCTTTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172960.1-1498s1c1
Sequence:CCGGCGTGAACACTTTGATGGCATACTCGAGTATGCCATCAAAGTGTTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172960.1-999s1c1
Sequence:CCGGGCACTTCCACTATGTTGTTATCTCGAGATAACAACATAGTGGAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172960.1-1335s1c1
Sequence:CCGGCCTGAGGGACAATGCTGCAATCTCGAGATTGCAGCATTGTCCCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172960
VALIDATED
ADCK5 MISSION shRNA Lentiviral Transduction Particles
aarF domain containing kinase 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172960.3-787s21c1
Sequence:CCGGTGGCACTGATGTAGCTGTAAACTCGAGTTTACAGCTACATCAGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172960.3-1505s21c1
Sequence:CCGGGAACACTTTGATGGCATAATGCTCGAGCATTATGCCATCAAAGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172960.3-422s21c1
Sequence:CCGGGACTACTGGTGGTGCACAAACCTCGAGGTTTGTGCACCACCAGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172960.3-957s21c1
Sequence:CCGGTCGAGAATGAGGGCCGAAATGCTCGAGCATTTCGGCCCTCATTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172960.3-1723s21c1
Sequence:CCGGGGTCCTCTGGGAGGCATTAAACTCGAGTTTAATGCCTCCCAGAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172960.1-796s1c1
Sequence:CCGGGCTGTAAAGGTACAGTACATTCTCGAGAATGTACTGTACCTTTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172960.1-1498s1c1
Sequence:CCGGCGTGAACACTTTGATGGCATACTCGAGTATGCCATCAAAGTGTTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172960.1-999s1c1
Sequence:CCGGGCACTTCCACTATGTTGTTATCTCGAGATAACAACATAGTGGAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172960.1-1335s1c1
Sequence:CCGGCCTGAGGGACAATGCTGCAATCTCGAGATTGCAGCATTGTCCCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174922
VALIDATED
ADCK5 MISSION shRNA Bacterial Glycerol Stock
aarF domain containing kinase 5
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174922.3-1658s21c1
Sequence:CCGGTCTGGGAGATGCTCAAGTTTGCTCGAGCAAACTTGAGCATCTCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174922.3-1552s21c1
Sequence:CCGGCGCTACTTCCTTATGGCTAAACTCGAGTTTAGCCATAAGGAAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174922.3-638s21c1
Sequence:CCGGACGAGCTCTTCCAGGAGTTTGCTCGAGCAAACTCCTGGAAGAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174922.3-1090s21c1
Sequence:CCGGGCCTTTGCTGAGCAGATATTTCTCGAGAAATATCTGCTCAGCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174922.3-875s21c1
Sequence:CCGGAGGAGCTGGACTTCGAGAATGCTCGAGCATTCTCGAAGTCCAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174922.3-1729s1c1
Sequence:CCGGGCTCGTGCTCTGGTCCACCTGCTCGAGCAGGTGGACCAGAGCACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174922.3-135s1c1
Sequence:CCGGGTTCTTCAGGAGAAACGTCAGCTCGAGCTGACGTTTCTCCTGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_174922.3-354s1c1
Sequence:CCGGCTACTGGTGGTGCACCAATGTCTCGAGACATTGGTGCACCACCAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174922.3-244s1c1
Sequence:CCGGGCCCGCTATGTCATGGCAGAGCTCGAGCTCTGCCATGACATAGCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174922.3-1090s1c1
Sequence:CCGGGCCTTTGCTGAGCAGATATTTCTCGAGAAATATCTGCTCAGCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021479    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174922.3-1816s1c1
Sequence:CCGGCGGCGGGGCCCTTTTCACCTTCTCGAGAAGGTGAAAAGGGCCCCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174922.3-1057s1c1
Sequence:CCGGGCAGTGCATGACATAGCAGAACTCGAGTTCTGCTATGTCATGCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174922.3-652s1c1
Sequence:CCGGGAGTTTGACTACCAGCCAATTCTCGAGAATTGGCTGGTAGTCAAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174922
VALIDATED
ADCK5 MISSION shRNA shRNA Plasmid DNA
aarF domain containing kinase 5
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174922.3-1658s21c1
Sequence:CCGGTCTGGGAGATGCTCAAGTTTGCTCGAGCAAACTTGAGCATCTCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174922.3-1552s21c1
Sequence:CCGGCGCTACTTCCTTATGGCTAAACTCGAGTTTAGCCATAAGGAAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174922.3-638s21c1
Sequence:CCGGACGAGCTCTTCCAGGAGTTTGCTCGAGCAAACTCCTGGAAGAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174922.3-1090s21c1
Sequence:CCGGGCCTTTGCTGAGCAGATATTTCTCGAGAAATATCTGCTCAGCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174922.3-875s21c1
Sequence:CCGGAGGAGCTGGACTTCGAGAATGCTCGAGCATTCTCGAAGTCCAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174922.3-1729s1c1
Sequence:CCGGGCTCGTGCTCTGGTCCACCTGCTCGAGCAGGTGGACCAGAGCACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174922.3-135s1c1
Sequence:CCGGGTTCTTCAGGAGAAACGTCAGCTCGAGCTGACGTTTCTCCTGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_174922.3-354s1c1
Sequence:CCGGCTACTGGTGGTGCACCAATGTCTCGAGACATTGGTGCACCACCAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174922.3-244s1c1
Sequence:CCGGGCCCGCTATGTCATGGCAGAGCTCGAGCTCTGCCATGACATAGCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174922.3-1090s1c1
Sequence:CCGGGCCTTTGCTGAGCAGATATTTCTCGAGAAATATCTGCTCAGCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021479    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174922.3-1816s1c1
Sequence:CCGGCGGCGGGGCCCTTTTCACCTTCTCGAGAAGGTGAAAAGGGCCCCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174922.3-1057s1c1
Sequence:CCGGGCAGTGCATGACATAGCAGAACTCGAGTTCTGCTATGTCATGCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174922.3-652s1c1
Sequence:CCGGGAGTTTGACTACCAGCCAATTCTCGAGAATTGGCTGGTAGTCAAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174922
VALIDATED
ADCK5 MISSION shRNA Lentiviral Transduction Particles
aarF domain containing kinase 5
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174922.3-1658s21c1
Sequence:CCGGTCTGGGAGATGCTCAAGTTTGCTCGAGCAAACTTGAGCATCTCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174922.3-1552s21c1
Sequence:CCGGCGCTACTTCCTTATGGCTAAACTCGAGTTTAGCCATAAGGAAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174922.3-638s21c1
Sequence:CCGGACGAGCTCTTCCAGGAGTTTGCTCGAGCAAACTCCTGGAAGAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174922.3-1090s21c1
Sequence:CCGGGCCTTTGCTGAGCAGATATTTCTCGAGAAATATCTGCTCAGCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174922.3-875s21c1
Sequence:CCGGAGGAGCTGGACTTCGAGAATGCTCGAGCATTCTCGAAGTCCAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174922.3-1729s1c1
Sequence:CCGGGCTCGTGCTCTGGTCCACCTGCTCGAGCAGGTGGACCAGAGCACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174922.3-135s1c1
Sequence:CCGGGTTCTTCAGGAGAAACGTCAGCTCGAGCTGACGTTTCTCCTGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_174922.3-354s1c1
Sequence:CCGGCTACTGGTGGTGCACCAATGTCTCGAGACATTGGTGCACCACCAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174922.3-244s1c1
Sequence:CCGGGCCCGCTATGTCATGGCAGAGCTCGAGCTCTGCCATGACATAGCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174922.3-1090s1c1
Sequence:CCGGGCCTTTGCTGAGCAGATATTTCTCGAGAAATATCTGCTCAGCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021479    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174922.3-1816s1c1
Sequence:CCGGCGGCGGGGCCCTTTTCACCTTCTCGAGAAGGTGAAAAGGGCCCCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174922.3-1057s1c1
Sequence:CCGGGCAGTGCATGACATAGCAGAACTCGAGTTCTGCTATGTCATGCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174922.3-652s1c1
Sequence:CCGGGAGTTTGACTACCAGCCAATTCTCGAGAATTGGCTGGTAGTCAAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks