EMAIL THIS PAGE TO A FRIEND

ADCY10

adenylate cyclase 10 (soluble)

54 Gene Product Result for
Synonyms: HCA2 RP1-313L4.2 SAC SACI Sacy
Gene ID:
Human(55811) Summary: The protein encoded by this gene belongs to a distinct class of mammalian adenylyl cyclase that is soluble and insensitive to G protein or forskolin regulation. It is thought to function as a general bicarbonate sensor throughout the body. It may also play an important role in the generation of cAMP in spermatozoa, implying possible roles in sperm maturation through the epididymis, capacitation, hypermotility, and/or the acrosome reaction. Genetic variations in this gene are associated with absorptive hypercalciuria type 2. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
Mouse(271639) adenylate cyclase 10
Rat(59320) adenylate cyclase 10 (soluble)
sheep(101111248) adenylate cyclase 10 (soluble)
domestic guinea pig(100721701) adenylate cyclase 10 (soluble)
naked mole-rat(101725888) adenylate cyclase 10 (soluble)
chicken(770187) adenylate cyclase 10 (soluble)
chicken(101752207) adenylate cyclase 10 (soluble)
chicken(101668915) adenylate cyclase 10 (soluble)
dog(480087) adenylate cyclase 10 (soluble)
cow(521844) adenylate cyclase 10 (soluble)
domestic cat(101099099) adenylate cyclase 10 (soluble)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173029 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173029 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173029 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018417 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018417 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018417 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018417 Rosetta Predictions human pricing
NM_021684 Rosetta Predictions rat pricing
NM_173029 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018417 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351923 predicted 2550
2 SASI_Hs01_00105207 predicted 3697
3 SASI_Hs01_00105208 predicted 3478
4 SASI_Hs01_00105210 predicted 3024
5 SASI_Hs02_00351924 predicted 3118
6 SASI_Hs01_00105212 predicted 2704
7 SASI_Hs02_00351925 predicted 3727
8 SASI_Hs01_00105213 predicted 3104
9 SASI_Hs01_00105214 predicted 2846
10 SASI_Hs01_00105216 predicted 226
11 SASI_Hs01_00105209 predicted 1716
12 SASI_Hs01_00105211 predicted 530
13 SASI_Hs01_00105215 predicted 4664
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021684 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054848 predicted 2965
2 SASI_Rn01_00054849 predicted 1869
3 SASI_Rn01_00054850 predicted 1992
4 SASI_Rn02_00262709 predicted 4289
5 SASI_Rn01_00054851 predicted 4771
6 SASI_Rn01_00054852 predicted 3589
7 SASI_Rn01_00054853 predicted 1262
8 SASI_Rn01_00054854 predicted 1937
9 SASI_Rn01_00054855 predicted 441
10 SASI_Rn01_00054856 predicted 674
11 SASI_Rn01_00054857 predicted 539
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173029 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112055 predicted 693
2 SASI_Mm01_00112057 predicted 2868
3 SASI_Mm01_00112058 predicted 1851
4 SASI_Mm01_00112059 predicted 1514
5 SASI_Mm01_00112060 predicted 2584
6 SASI_Mm01_00112061 predicted 755
7 SASI_Mm01_00112062 predicted 2323
8 SASI_Mm02_00345097 predicted 1684
9 SASI_Mm02_00345098 predicted 3499
10 SASI_Mm02_00345099 predicted 1837
11 SASI_Mm01_00112054 predicted 4885
12 SASI_Mm01_00112056 predicted 228
13 SASI_Mm01_00112063 predicted 1117
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173029
ADCY10 MISSION shRNA Bacterial Glycerol Stock
adenylate cyclase 10 (soluble)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173029.3-279s21c1
Sequence:CCGGCCTCATCGTCTACGGAGATTTCTCGAGAAATCTCCGTAGACGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173029.3-4889s21c1
Sequence:CCGGGGTACTCAGCCTCCGAGTTAACTCGAGTTAACTCGGAGGCTGAGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173029.3-1786s21c1
Sequence:CCGAGTACTCATGGAAATCGAATATCTCGAGATATTCGATTTCCATGAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173029.1-3429s1c1
Sequence:CCGGGCCCAACATTTCGTAGCCTTACTCGAGTAAGGCTACGAAATGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173029.1-759s1c1
Sequence:CCGGGCTCAGATGAACGACGTTATTCTCGAGAATAACGTCGTTCATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173029.1-2876s1c1
Sequence:CCGGGCCAACATTTGAGGTTCATTACTCGAGTAATGAACCTCAAATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173029.1-4083s1c1
Sequence:CCGGGCCATTGAGATCATGGCGTATCTCGAGATACGCCATGATCTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173029.1-4206s1c1
Sequence:CCGGCCCAACAAATACCAGATGGTTCTCGAGAACCATCTGGTATTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173029
ADCY10 MISSION shRNA shRNA Plasmid DNA
adenylate cyclase 10 (soluble)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173029.3-279s21c1
Sequence:CCGGCCTCATCGTCTACGGAGATTTCTCGAGAAATCTCCGTAGACGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173029.3-4889s21c1
Sequence:CCGGGGTACTCAGCCTCCGAGTTAACTCGAGTTAACTCGGAGGCTGAGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173029.3-1786s21c1
Sequence:CCGAGTACTCATGGAAATCGAATATCTCGAGATATTCGATTTCCATGAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173029.1-3429s1c1
Sequence:CCGGGCCCAACATTTCGTAGCCTTACTCGAGTAAGGCTACGAAATGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173029.1-759s1c1
Sequence:CCGGGCTCAGATGAACGACGTTATTCTCGAGAATAACGTCGTTCATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173029.1-2876s1c1
Sequence:CCGGGCCAACATTTGAGGTTCATTACTCGAGTAATGAACCTCAAATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173029.1-4083s1c1
Sequence:CCGGGCCATTGAGATCATGGCGTATCTCGAGATACGCCATGATCTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173029.1-4206s1c1
Sequence:CCGGCCCAACAAATACCAGATGGTTCTCGAGAACCATCTGGTATTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173029
ADCY10 MISSION shRNA Lentiviral Transduction Particles
adenylate cyclase 10 (soluble)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173029.3-279s21c1
Sequence:CCGGCCTCATCGTCTACGGAGATTTCTCGAGAAATCTCCGTAGACGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173029.3-4889s21c1
Sequence:CCGGGGTACTCAGCCTCCGAGTTAACTCGAGTTAACTCGGAGGCTGAGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173029.3-1786s21c1
Sequence:CCGAGTACTCATGGAAATCGAATATCTCGAGATATTCGATTTCCATGAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173029.1-3429s1c1
Sequence:CCGGGCCCAACATTTCGTAGCCTTACTCGAGTAAGGCTACGAAATGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173029.1-759s1c1
Sequence:CCGGGCTCAGATGAACGACGTTATTCTCGAGAATAACGTCGTTCATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173029.1-2876s1c1
Sequence:CCGGGCCAACATTTGAGGTTCATTACTCGAGTAATGAACCTCAAATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173029.1-4083s1c1
Sequence:CCGGGCCATTGAGATCATGGCGTATCTCGAGATACGCCATGATCTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173029.1-4206s1c1
Sequence:CCGGCCCAACAAATACCAGATGGTTCTCGAGAACCATCTGGTATTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018417
VALIDATED
ADCY10 MISSION shRNA Bacterial Glycerol Stock
adenylate cyclase 10 (soluble)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018417.3-2109s21c1
Sequence:CCGGTCCCTATTTCTCGGGAGATTTCTCGAGAAATCTCCCGAGAAATAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018417.2-1913s21c1
Sequence:CCGGACAGACCAACCTTCGAAATAACTCGAGTTATTTCGAAGGTTGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018417.2-280s21c1
Sequence:CCGGAGCGACCCTTTATGGATTATTCTCGAGAATAATCCATAAAGGGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018417.2-1831s1c2
Sequence:CCGGGCTTCCATCAAACTTTCTATACTCGAGTATAGAAAGTTTGATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018417.2-403s21c1
Sequence:CCGGAGATCCTCAACTACCACATAACTCGAGTTATGTGGTAGTTGAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018417.2-4556s21c1
Sequence:CCGGTACTTACTATGACGGAATATCCTCGAGGATATTCCGTCATAGTAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018417.2-1637s21c1
Sequence:CCGGCCCTTTGCTGGGACGTAATAACTCGAGTTATTACGTCCCAGCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018417.3-1690s21c1
Sequence:CCGGCCGTACTGAGAAAGTCATGTTCTCGAGAACATGACTTTCTCAGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018417.2-729s1c1
Sequence:CCGGGCTCAGATGAATGATGTTATTCTCGAGAATAACATCATTCATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018417.2-281s1c1
Sequence:CCGGGCGACCCTTTATGGATTATTTCTCGAGAAATAATCCATAAAGGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018417.2-2486s1c1
Sequence:CCGGCCTGTTCAAGTATTCCATTAACTCGAGTTAATGGAATACTTGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018417.2-1577s1c1
Sequence:CCGGCCGTACTGAGAAAGTCATGTTCTCGAGAACATGACTTTCTCAGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018417
VALIDATED
ADCY10 MISSION shRNA shRNA Plasmid DNA
adenylate cyclase 10 (soluble)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018417.3-2109s21c1
Sequence:CCGGTCCCTATTTCTCGGGAGATTTCTCGAGAAATCTCCCGAGAAATAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018417.2-1913s21c1
Sequence:CCGGACAGACCAACCTTCGAAATAACTCGAGTTATTTCGAAGGTTGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018417.2-280s21c1
Sequence:CCGGAGCGACCCTTTATGGATTATTCTCGAGAATAATCCATAAAGGGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018417.2-1831s1c2
Sequence:CCGGGCTTCCATCAAACTTTCTATACTCGAGTATAGAAAGTTTGATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018417.2-403s21c1
Sequence:CCGGAGATCCTCAACTACCACATAACTCGAGTTATGTGGTAGTTGAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018417.2-4556s21c1
Sequence:CCGGTACTTACTATGACGGAATATCCTCGAGGATATTCCGTCATAGTAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018417.2-1637s21c1
Sequence:CCGGCCCTTTGCTGGGACGTAATAACTCGAGTTATTACGTCCCAGCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018417.3-1690s21c1
Sequence:CCGGCCGTACTGAGAAAGTCATGTTCTCGAGAACATGACTTTCTCAGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018417.2-729s1c1
Sequence:CCGGGCTCAGATGAATGATGTTATTCTCGAGAATAACATCATTCATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018417.2-281s1c1
Sequence:CCGGGCGACCCTTTATGGATTATTTCTCGAGAAATAATCCATAAAGGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018417.2-2486s1c1
Sequence:CCGGCCTGTTCAAGTATTCCATTAACTCGAGTTAATGGAATACTTGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018417.2-1577s1c1
Sequence:CCGGCCGTACTGAGAAAGTCATGTTCTCGAGAACATGACTTTCTCAGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018417
VALIDATED
ADCY10 MISSION shRNA Lentiviral Transduction Particles
adenylate cyclase 10 (soluble)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018417.3-2109s21c1
Sequence:CCGGTCCCTATTTCTCGGGAGATTTCTCGAGAAATCTCCCGAGAAATAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018417.2-1913s21c1
Sequence:CCGGACAGACCAACCTTCGAAATAACTCGAGTTATTTCGAAGGTTGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018417.2-280s21c1
Sequence:CCGGAGCGACCCTTTATGGATTATTCTCGAGAATAATCCATAAAGGGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018417.2-1831s1c2
Sequence:CCGGGCTTCCATCAAACTTTCTATACTCGAGTATAGAAAGTTTGATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018417.2-403s21c1
Sequence:CCGGAGATCCTCAACTACCACATAACTCGAGTTATGTGGTAGTTGAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018417.2-4556s21c1
Sequence:CCGGTACTTACTATGACGGAATATCCTCGAGGATATTCCGTCATAGTAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018417.2-1637s21c1
Sequence:CCGGCCCTTTGCTGGGACGTAATAACTCGAGTTATTACGTCCCAGCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018417.3-1690s21c1
Sequence:CCGGCCGTACTGAGAAAGTCATGTTCTCGAGAACATGACTTTCTCAGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018417.2-729s1c1
Sequence:CCGGGCTCAGATGAATGATGTTATTCTCGAGAATAACATCATTCATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018417.2-281s1c1
Sequence:CCGGGCGACCCTTTATGGATTATTTCTCGAGAAATAATCCATAAAGGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018417.2-2486s1c1
Sequence:CCGGCCTGTTCAAGTATTCCATTAACTCGAGTTAATGGAATACTTGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018417.2-1577s1c1
Sequence:CCGGCCGTACTGAGAAAGTCATGTTCTCGAGAACATGACTTTCTCAGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks