EMAIL THIS PAGE TO A FRIEND

ADCY10P1

adenylate cyclase 10 (soluble) pseudogene 1

2 Gene Product Result for
Species: Human ADCY10P1(221442)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010871 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010871 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010871 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010871
ADCY10P1 MISSION shRNA Bacterial Glycerol Stock
adenylate cyclase 10 (soluble) pseudogene 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010871.1-511s1c1
Sequence:CCGGCTGCCTTGGTCATCTTGACTTCTCGAGAAGTCAAGATGACCAAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010871.1-538s1c1
Sequence:CCGGCAAGCTGGGTAATGGGACTTACTCGAGTAAGTCCCATTACCCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010871.1-239s1c1
Sequence:CCGGGAATTTCCCTTGGACCTGGTTCTCGAGAACCAGGTCCAAGGGAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158801    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010871.1-1793s1c1
Sequence:CCGGGCCTTAAAGAAGTGATGATTTCTCGAGAAATCATCACTTCTTTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161029    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010871.1-998s1c1
Sequence:CCGGGCGCTCATTTCTCAGAGTTATCTCGAGATAACTCTGAGAAATGAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010871.1-585s1c1
Sequence:CCGGGAGTACATGTTCACAGCTAGACTCGAGTCTAGCTGTGAACATGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010871
ADCY10P1 MISSION shRNA shRNA Plasmid DNA
adenylate cyclase 10 (soluble) pseudogene 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010871.1-511s1c1
Sequence:CCGGCTGCCTTGGTCATCTTGACTTCTCGAGAAGTCAAGATGACCAAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010871.1-538s1c1
Sequence:CCGGCAAGCTGGGTAATGGGACTTACTCGAGTAAGTCCCATTACCCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010871.1-239s1c1
Sequence:CCGGGAATTTCCCTTGGACCTGGTTCTCGAGAACCAGGTCCAAGGGAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158801    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010871.1-1793s1c1
Sequence:CCGGGCCTTAAAGAAGTGATGATTTCTCGAGAAATCATCACTTCTTTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161029    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010871.1-998s1c1
Sequence:CCGGGCGCTCATTTCTCAGAGTTATCTCGAGATAACTCTGAGAAATGAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010871.1-585s1c1
Sequence:CCGGGAGTACATGTTCACAGCTAGACTCGAGTCTAGCTGTGAACATGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010871
ADCY10P1 MISSION shRNA Lentiviral Transduction Particles
adenylate cyclase 10 (soluble) pseudogene 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010871.1-511s1c1
Sequence:CCGGCTGCCTTGGTCATCTTGACTTCTCGAGAAGTCAAGATGACCAAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010871.1-538s1c1
Sequence:CCGGCAAGCTGGGTAATGGGACTTACTCGAGTAAGTCCCATTACCCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010871.1-239s1c1
Sequence:CCGGGAATTTCCCTTGGACCTGGTTCTCGAGAACCAGGTCCAAGGGAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158801    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010871.1-1793s1c1
Sequence:CCGGGCCTTAAAGAAGTGATGATTTCTCGAGAAATCATCACTTCTTTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161029    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010871.1-998s1c1
Sequence:CCGGGCGCTCATTTCTCAGAGTTATCTCGAGATAACTCTGAGAAATGAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010871.1-585s1c1
Sequence:CCGGGAGTACATGTTCACAGCTAGACTCGAGTCTAGCTGTGAACATGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks