EMAIL THIS PAGE TO A FRIEND

ADCY1

adenylate cyclase 1 (brain)

118 Gene Product Result for
Synonyms: AC1
UniProtKB ID: Q08828, A4D2L8, Q75MI1
Gene ID:
Human(107) Summary: This gene encodes a form of adenylate cyclase expressed in brain. A similar protein in mouse is involved in pattern formation of the brain. [provided by RefSeq, Jul 2008]
Mouse(432530) adenylate cyclase 1
Rat(305509) adenylate cyclase 1 (brain)
chicken(420788) adenylate cyclase 1 (brain)
cow(281601) adenylate cyclase 1 (brain)
domestic cat(101101375) adenylate cyclase 1 (brain)
dog(607357) adenylate cyclase 1 (brain)
naked mole-rat(101711366) adenylate cyclase 1 (brain)
domestic guinea pig(100715672) adenylate cyclase 1 (brain)
sheep(101117327) adenylate cyclase 1 (brain)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500146 Anti-ADCY1 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing
SAB4300903 Anti-ADCY1 antibody produced in rabbit affinity isolated antibody mouse, human
western blot pricing
SAB4301056 Anti-ADCY1 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing

Small Molecule - Activator

Product # Description Species Add to Cart
 
A9808 Pituitary adenylate cyclase activating polypeptide-27 ovine ≥97% (HPLC), solid human, mouse, rat, sheep pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
S153 SQ 22,536 ≥97% (HPLC), powder human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009622 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009622 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009622 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021116 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021116 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021116 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021116 Rosetta Predictions human pricing
NM_001107239 Rosetta Predictions rat pricing
NM_009622 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021116 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226330 predicted 3189
2 SASI_Hs01_00226331 predicted 1372
3 SASI_Hs01_00226332 predicted 1893
4 SASI_Hs01_00226333 predicted 2064
5 SASI_Hs01_00226334 predicted 1502
6 SASI_Hs01_00226335 predicted 1476
7 SASI_Hs01_00226336 predicted 3110
8 SASI_Hs01_00226337 predicted 942
9 SASI_Hs01_00226338 predicted 1982
10 SASI_Hs01_00226339 predicted 1728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107239 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226885 predicted 1725
2 SASI_Rn02_00226886 predicted 883
3 SASI_Rn02_00226887 predicted 1297
4 SASI_Rn02_00226888 predicted 1307
5 SASI_Rn02_00226889 predicted 520
6 SASI_Rn02_00226890 predicted 2712
7 SASI_Rn02_00226891 predicted 1623
8 SASI_Rn02_00226892 predicted 2412
9 SASI_Rn02_00226893 predicted 2991
10 SASI_Rn02_00226894 predicted 1428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009622 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190619 predicted 1973
2 SASI_Mm01_00190620 predicted 1603
3 SASI_Mm01_00190621 predicted 1871
4 SASI_Mm01_00190622 predicted 1516
5 SASI_Mm01_00190623 predicted 1137
6 SASI_Mm01_00190624 predicted 3152
7 SASI_Mm01_00190625 predicted 1734
8 SASI_Mm01_00190626 predicted 770
9 SASI_Mm01_00190627 predicted 1967
10 SASI_Mm01_00190628 predicted 2730
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009622
ADCY1 MISSION shRNA Bacterial Glycerol Stock
adenylate cyclase 1 (brain)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009622.1-2146s1c1
Sequence:CCGGGTGGTCTTAATCTACTCGGTACTCGAGTACCGAGTAGATTAAGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009622.1-3250s1c1
Sequence:CCGGGAGATGCTAACGTACTTTCTACTCGAGTAGAAAGTACGTTAGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009622.1-1143s1c1
Sequence:CCGGCCGAATCAAGATCCTTGGTGACTCGAGTCACCAAGGATCTTGATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216862    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009622.1-11951s1c1
Sequence:CCGGGCTATGAGAACTCGATGATTACTCGAGTAATCATCGAGTTCTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009622.1-1754s21c1
Sequence:CCGGGTTCGTCTTTCTCTACTAATGCTCGAGCATTAGTAGAGAAAGACGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009622.1-7834s21c1
Sequence:CCGGCATCTACCCTTCACGTAATAGCTCGAGCTATTACGTGAAGGGTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009622.1-1853s21c1
Sequence:CCGGTGGCCGATCTGAACTTCTTTACTCGAGTAAAGAAGTTCAGATCGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009622.1-2319s21c1
Sequence:CCGGCACCCTCCCACTAGCCATATTCTCGAGAATATGGCTAGTGGGAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009622.1-1567s21c1
Sequence:CCGGGGCTTGATTCTCTCGGATATCCTCGAGGATATCCGAGAGAATCAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009622
ADCY1 MISSION shRNA shRNA Plasmid DNA
adenylate cyclase 1 (brain)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009622.1-2146s1c1
Sequence:CCGGGTGGTCTTAATCTACTCGGTACTCGAGTACCGAGTAGATTAAGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009622.1-3250s1c1
Sequence:CCGGGAGATGCTAACGTACTTTCTACTCGAGTAGAAAGTACGTTAGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009622.1-1143s1c1
Sequence:CCGGCCGAATCAAGATCCTTGGTGACTCGAGTCACCAAGGATCTTGATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216862    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009622.1-11951s1c1
Sequence:CCGGGCTATGAGAACTCGATGATTACTCGAGTAATCATCGAGTTCTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009622.1-1754s21c1
Sequence:CCGGGTTCGTCTTTCTCTACTAATGCTCGAGCATTAGTAGAGAAAGACGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009622.1-7834s21c1
Sequence:CCGGCATCTACCCTTCACGTAATAGCTCGAGCTATTACGTGAAGGGTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009622.1-1853s21c1
Sequence:CCGGTGGCCGATCTGAACTTCTTTACTCGAGTAAAGAAGTTCAGATCGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009622.1-2319s21c1
Sequence:CCGGCACCCTCCCACTAGCCATATTCTCGAGAATATGGCTAGTGGGAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009622.1-1567s21c1
Sequence:CCGGGGCTTGATTCTCTCGGATATCCTCGAGGATATCCGAGAGAATCAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009622
ADCY1 MISSION shRNA Lentiviral Transduction Particles
adenylate cyclase 1 (brain)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009622.1-2146s1c1
Sequence:CCGGGTGGTCTTAATCTACTCGGTACTCGAGTACCGAGTAGATTAAGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009622.1-3250s1c1
Sequence:CCGGGAGATGCTAACGTACTTTCTACTCGAGTAGAAAGTACGTTAGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009622.1-1143s1c1
Sequence:CCGGCCGAATCAAGATCCTTGGTGACTCGAGTCACCAAGGATCTTGATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216862    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009622.1-11951s1c1
Sequence:CCGGGCTATGAGAACTCGATGATTACTCGAGTAATCATCGAGTTCTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009622.1-1754s21c1
Sequence:CCGGGTTCGTCTTTCTCTACTAATGCTCGAGCATTAGTAGAGAAAGACGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009622.1-7834s21c1
Sequence:CCGGCATCTACCCTTCACGTAATAGCTCGAGCTATTACGTGAAGGGTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009622.1-1853s21c1
Sequence:CCGGTGGCCGATCTGAACTTCTTTACTCGAGTAAAGAAGTTCAGATCGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009622.1-2319s21c1
Sequence:CCGGCACCCTCCCACTAGCCATATTCTCGAGAATATGGCTAGTGGGAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009622.1-1567s21c1
Sequence:CCGGGGCTTGATTCTCTCGGATATCCTCGAGGATATCCGAGAGAATCAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021116
VALIDATED
ADCY1 MISSION shRNA Bacterial Glycerol Stock
adenylate cyclase 1 (brain)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_021116.1-1942s1c1
Sequence:CCGGGCTAGTATTCTGCATCTGCTTCTCGAGAAGCAGATGCAGAATACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021116.1-1634s1c1
Sequence:CCGGGCATTAAGAACAGCCTCGGAACTCGAGTTCCGAGGCTGTTCTTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_021116.1-1027s1c1
Sequence:CCGGCGATGAATTAGCCACGGAGAACTCGAGTTCTCCGTGGCTAATTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_021116.1-1483s1c1
Sequence:CCGGCCTGATTCTCTCAGATATAAACTCGAGTTTATATCTGAGAGAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_021116.1-7206s1c1
Sequence:CCGGCCCGTGTTTCTCAGACTTTAACTCGAGTTAAAGTCTGAGAAACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021116.2-3158s21c1
Sequence:CCGGGCGAGATGTTGACATACTTTCCTCGAGGAAAGTATGTCAACATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021116.2-1479s21c1
Sequence:CCGGCCTGATTCTCTCAGATATAAACTCGAGTTTATATCTGAGAGAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021116.2-1938s21c1
Sequence:CCGGGCTAGTATTCTGCATCTGCTTCTCGAGAAGCAGATGCAGAATACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021116.2-1824s21c1
Sequence:CCGGCCAGCTTCAGGACGAGTATTTCTCGAGAAATACTCGTCCTGAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021116.2-2230s21c1
Sequence:CCGGACCCTCCCGCTAGCCATATTTCTCGAGAAATATGGCTAGCGGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021116
VALIDATED
ADCY1 MISSION shRNA shRNA Plasmid DNA
adenylate cyclase 1 (brain)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_021116.1-1942s1c1
Sequence:CCGGGCTAGTATTCTGCATCTGCTTCTCGAGAAGCAGATGCAGAATACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021116.1-1634s1c1
Sequence:CCGGGCATTAAGAACAGCCTCGGAACTCGAGTTCCGAGGCTGTTCTTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_021116.1-1027s1c1
Sequence:CCGGCGATGAATTAGCCACGGAGAACTCGAGTTCTCCGTGGCTAATTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_021116.1-1483s1c1
Sequence:CCGGCCTGATTCTCTCAGATATAAACTCGAGTTTATATCTGAGAGAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_021116.1-7206s1c1
Sequence:CCGGCCCGTGTTTCTCAGACTTTAACTCGAGTTAAAGTCTGAGAAACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021116.2-3158s21c1
Sequence:CCGGGCGAGATGTTGACATACTTTCCTCGAGGAAAGTATGTCAACATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021116.2-1479s21c1
Sequence:CCGGCCTGATTCTCTCAGATATAAACTCGAGTTTATATCTGAGAGAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021116.2-1938s21c1
Sequence:CCGGGCTAGTATTCTGCATCTGCTTCTCGAGAAGCAGATGCAGAATACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021116.2-1824s21c1
Sequence:CCGGCCAGCTTCAGGACGAGTATTTCTCGAGAAATACTCGTCCTGAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021116.2-2230s21c1
Sequence:CCGGACCCTCCCGCTAGCCATATTTCTCGAGAAATATGGCTAGCGGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021116
VALIDATED
ADCY1 MISSION shRNA Lentiviral Transduction Particles
adenylate cyclase 1 (brain)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_021116.1-1942s1c1
Sequence:CCGGGCTAGTATTCTGCATCTGCTTCTCGAGAAGCAGATGCAGAATACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021116.1-1634s1c1
Sequence:CCGGGCATTAAGAACAGCCTCGGAACTCGAGTTCCGAGGCTGTTCTTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_021116.1-1027s1c1
Sequence:CCGGCGATGAATTAGCCACGGAGAACTCGAGTTCTCCGTGGCTAATTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_021116.1-1483s1c1
Sequence:CCGGCCTGATTCTCTCAGATATAAACTCGAGTTTATATCTGAGAGAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_021116.1-7206s1c1
Sequence:CCGGCCCGTGTTTCTCAGACTTTAACTCGAGTTAAAGTCTGAGAAACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021116.2-3158s21c1
Sequence:CCGGGCGAGATGTTGACATACTTTCCTCGAGGAAAGTATGTCAACATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021116.2-1479s21c1
Sequence:CCGGCCTGATTCTCTCAGATATAAACTCGAGTTTATATCTGAGAGAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021116.2-1938s21c1
Sequence:CCGGGCTAGTATTCTGCATCTGCTTCTCGAGAAGCAGATGCAGAATACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021116.2-1824s21c1
Sequence:CCGGCCAGCTTCAGGACGAGTATTTCTCGAGAAATACTCGTCCTGAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021116.2-2230s21c1
Sequence:CCGGACCCTCCCGCTAGCCATATTTCTCGAGAAATATGGCTAGCGGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks