EMAIL THIS PAGE TO A FRIEND

ADCY2

adenylate cyclase 2 (brain)

111 Gene Product Result for
Synonyms: AC2 HBAC2
UniProtKB ID: Q08462, Q2NKL8, Q9UDB2, Q9UPU2
Gene ID:
Human(108) Summary: This gene encodes a member of the family of adenylate cyclases, which are membrane-associated enzymes that catalyze the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). This enzyme is insensitive to Ca(2+)/calmodulin, and is stimulated by the G protein beta and gamma subunit complex. [provided by RefSeq, Jul 2008]
Mouse(210044) adenylate cyclase 2
Rat(81636) adenylate cyclase 2 (brain)
chicken(420935) adenylate cyclase 2 (brain)
cow(281602) adenylate cyclase 2
cow(510708) adenylate cyclase 2 (brain)
Horse(100071337) adenylate cyclase 2 (brain)
dog(478624) adenylate cyclase 2 (brain)
domestic cat(101094327) adenylate cyclase 2 (brain)
naked mole-rat(101718304) adenylate cyclase 2 (brain)
domestic guinea pig(100731999) adenylate cyclase 2 (brain)
sheep(101102089) adenylate cyclase 2 (brain)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153534 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153534 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153534 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020546 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020546 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020546 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020546 Rosetta Predictions human pricing
NM_031007 Rosetta Predictions rat pricing
NM_153534 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020546 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062565 predicted 3100
2 SASI_Hs01_00062566 predicted 2694
3 SASI_Hs02_00353583 predicted 958
4 SASI_Hs01_00062567 predicted 1092
5 SASI_Hs01_00062568 predicted 1399
6 SASI_Hs01_00062569 predicted 467
7 SASI_Hs01_00062570 predicted 1080
8 SASI_Hs01_00062571 predicted 714
9 SASI_Hs01_00062572 predicted 2304
10 SASI_Hs01_00062573 predicted 938
11 SASI_Hs01_00062574 predicted 1873
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031007 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103410 predicted 1018
2 SASI_Rn01_00103411 predicted 3071
3 SASI_Rn01_00103412 predicted 2836
4 SASI_Rn01_00103413 predicted 2376
5 SASI_Rn01_00103415 predicted 1670
6 SASI_Rn01_00103416 predicted 3297
7 SASI_Rn01_00103417 predicted 889
8 SASI_Rn02_00264196 predicted 3022
9 SASI_Rn01_00103418 predicted 2224
10 SASI_Rn01_00103419 predicted 1859
11 SASI_Rn01_00103414 predicted 2302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153534 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055847 predicted 1865
2 SASI_Mm01_00055848 predicted 1594
3 SASI_Mm01_00055849 predicted 3470
4 SASI_Mm01_00055850 predicted 3264
5 SASI_Mm01_00055851 predicted 3434
6 SASI_Mm01_00055852 predicted 2433
7 SASI_Mm01_00055853 predicted 2640
8 SASI_Mm01_00055854 predicted 2392
9 SASI_Mm02_00343297 predicted 2319
10 SASI_Mm02_00343298 predicted 1598
11 SASI_Mm01_00055846 predicted 996
12 SASI_Mm01_00055855 predicted 786
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153534
ADCY2 MISSION shRNA Bacterial Glycerol Stock
adenylate cyclase 2 (brain)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153534.1-1350s1c1
Sequence:CCGGCGGTGAGATAAGAGACCCATACTCGAGTATGGGTCTCTTATCTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153534.1-1117s1c1
Sequence:CCGGGCCATAAAGAAAGTGAGGGATCTCGAGATCCCTCACTTTCTTTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153534.1-2804s1c1
Sequence:CCGGCGAAGTTCAGTGGCGTTGAAACTCGAGTTTCAACGCCACTGAACTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153534.1-2904s1c1
Sequence:CCGGCGAGCGTCAATACATGCACATCTCGAGATGTGCATGTATTGACGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110770    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153534.1-3497s1c1
Sequence:CCGGCCTAAGCAGAAGGAGAAGGAACTCGAGTTCCTTCTCCTTCTGCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153534.2-3272s21c1
Sequence:CCGGCTGTAATAGCTGGCGTCATAGCTCGAGCTATGACGCCAGCTATTACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153534.2-1839s21c1
Sequence:CCGGTGTGCCAATGGGTCAACATAACTCGAGTTATGTTGACCCATTGGCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153534
ADCY2 MISSION shRNA shRNA Plasmid DNA
adenylate cyclase 2 (brain)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153534.1-1350s1c1
Sequence:CCGGCGGTGAGATAAGAGACCCATACTCGAGTATGGGTCTCTTATCTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153534.1-1117s1c1
Sequence:CCGGGCCATAAAGAAAGTGAGGGATCTCGAGATCCCTCACTTTCTTTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153534.1-2804s1c1
Sequence:CCGGCGAAGTTCAGTGGCGTTGAAACTCGAGTTTCAACGCCACTGAACTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153534.1-2904s1c1
Sequence:CCGGCGAGCGTCAATACATGCACATCTCGAGATGTGCATGTATTGACGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110770    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153534.1-3497s1c1
Sequence:CCGGCCTAAGCAGAAGGAGAAGGAACTCGAGTTCCTTCTCCTTCTGCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153534.2-3272s21c1
Sequence:CCGGCTGTAATAGCTGGCGTCATAGCTCGAGCTATGACGCCAGCTATTACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153534.2-1839s21c1
Sequence:CCGGTGTGCCAATGGGTCAACATAACTCGAGTTATGTTGACCCATTGGCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153534
ADCY2 MISSION shRNA Lentiviral Transduction Particles
adenylate cyclase 2 (brain)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153534.1-1350s1c1
Sequence:CCGGCGGTGAGATAAGAGACCCATACTCGAGTATGGGTCTCTTATCTCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153534.1-1117s1c1
Sequence:CCGGGCCATAAAGAAAGTGAGGGATCTCGAGATCCCTCACTTTCTTTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153534.1-2804s1c1
Sequence:CCGGCGAAGTTCAGTGGCGTTGAAACTCGAGTTTCAACGCCACTGAACTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153534.1-2904s1c1
Sequence:CCGGCGAGCGTCAATACATGCACATCTCGAGATGTGCATGTATTGACGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110770    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153534.1-3497s1c1
Sequence:CCGGCCTAAGCAGAAGGAGAAGGAACTCGAGTTCCTTCTCCTTCTGCTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153534.2-3272s21c1
Sequence:CCGGCTGTAATAGCTGGCGTCATAGCTCGAGCTATGACGCCAGCTATTACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153534.2-1839s21c1
Sequence:CCGGTGTGCCAATGGGTCAACATAACTCGAGTTATGTTGACCCATTGGCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020546
ADCY2 MISSION shRNA Bacterial Glycerol Stock
adenylate cyclase 2 (brain)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020546.1-6213s1c1
Sequence:CCGGGCAACCATTCATCTTTCCTTTCTCGAGAAAGGAAAGATGAATGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020546.1-2330s1c1
Sequence:CCGGGCGGGTAAACTATGAGCTGAACTCGAGTTCAGCTCATAGTTTACCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020546.1-3243s1c1
Sequence:CCGGCGAGGAATAATCAACGTGAAACTCGAGTTTCACGTTGATTATTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020546.1-295s1c1
Sequence:CCGGCGTTTCTAATAACAGTTCCAACTCGAGTTGGAACTGTTATTAGAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020546.1-1861s1c1
Sequence:CCGGCGTTCAAGTATTATGTGACTTCTCGAGAAGTCACATAATACTTGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020546
ADCY2 MISSION shRNA shRNA Plasmid DNA
adenylate cyclase 2 (brain)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020546.1-6213s1c1
Sequence:CCGGGCAACCATTCATCTTTCCTTTCTCGAGAAAGGAAAGATGAATGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020546.1-2330s1c1
Sequence:CCGGGCGGGTAAACTATGAGCTGAACTCGAGTTCAGCTCATAGTTTACCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020546.1-3243s1c1
Sequence:CCGGCGAGGAATAATCAACGTGAAACTCGAGTTTCACGTTGATTATTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020546.1-295s1c1
Sequence:CCGGCGTTTCTAATAACAGTTCCAACTCGAGTTGGAACTGTTATTAGAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020546.1-1861s1c1
Sequence:CCGGCGTTCAAGTATTATGTGACTTCTCGAGAAGTCACATAATACTTGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020546
ADCY2 MISSION shRNA Lentiviral Transduction Particles
adenylate cyclase 2 (brain)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020546.1-6213s1c1
Sequence:CCGGGCAACCATTCATCTTTCCTTTCTCGAGAAAGGAAAGATGAATGGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020546.1-2330s1c1
Sequence:CCGGGCGGGTAAACTATGAGCTGAACTCGAGTTCAGCTCATAGTTTACCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020546.1-3243s1c1
Sequence:CCGGCGAGGAATAATCAACGTGAAACTCGAGTTTCACGTTGATTATTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020546.1-295s1c1
Sequence:CCGGCGTTTCTAATAACAGTTCCAACTCGAGTTGGAACTGTTATTAGAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020546.1-1861s1c1
Sequence:CCGGCGTTCAAGTATTATGTGACTTCTCGAGAAGTCACATAATACTTGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)