EMAIL THIS PAGE TO A FRIEND

ADCY3

adenylate cyclase 3

52 Gene Product Result for
Synonyms: AC3
UniProtKB ID: O60266, Q53T54, Q9UDB1
Gene ID:
Human(109) Summary: This gene encodes adenylyl cyclase 3 which is a membrane-associated enzyme and catalyzes the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). This protein appears to be widely expressed in various human tissues and may be involved in a number of physiological and pathophysiological metabolic processes. [provided by RefSeq, Jul 2008]
Mouse(104111) adenylate cyclase 3
Rat(64508) adenylate cyclase 3
chicken(422013) adenylate cyclase 3
dog(482994) adenylate cyclase 3
domestic cat(101088157) adenylate cyclase 3
cow(535603) adenylate cyclase 3
sheep(101108203) adenylate cyclase 3
domestic guinea pig(100725667) adenylate cyclase 3
naked mole-rat(101713887) adenylate cyclase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301157 Anti-ADCY3 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
S153 SQ 22,536 ≥97% (HPLC), powder human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138305 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138305 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138305 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004036 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004036 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004036 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004036 Rosetta Predictions human pricing
NM_130779 Rosetta Predictions rat pricing
NM_138305 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004036 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085785 predicted 3023
2 SASI_Hs01_00085786 predicted 1281
3 SASI_Hs01_00085787 predicted 763
4 SASI_Hs02_00336782 predicted 3561
5 SASI_Hs01_00085789 predicted 3709
6 SASI_Hs01_00085791 predicted 2932
7 SASI_Hs02_00336783 predicted 630
8 SASI_Hs01_00085792 predicted 3471
9 SASI_Hs02_00336784 predicted 3126
10 SASI_Hs02_00336785 predicted 2945
11 SASI_Hs01_00085783 predicted 2711
12 SASI_Hs01_00085784 predicted 3670
13 SASI_Hs01_00085788 predicted 1124
14 SASI_Hs01_00085790 predicted 2215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130779 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101925 predicted 1024
2 SASI_Rn01_00101926 predicted 1523
3 SASI_Rn01_00101927 predicted 3482
4 SASI_Rn01_00101928 predicted 2877
5 SASI_Rn01_00101929 predicted 1926
6 SASI_Rn01_00101930 predicted 2180
7 SASI_Rn01_00101931 predicted 1287
8 SASI_Rn01_00101932 predicted 3186
9 SASI_Rn01_00101933 predicted 1002
10 SASI_Rn01_00101934 predicted 3679
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138305 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139448 predicted 1073
2 SASI_Mm01_00139449 predicted 3191
3 SASI_Mm01_00139450 predicted 1226
4 SASI_Mm02_00339606 predicted 3193
5 SASI_Mm01_00139451 predicted 2204
6 SASI_Mm02_00339607 predicted 2101
7 SASI_Mm01_00139454 predicted 2898
8 SASI_Mm01_00139455 predicted 2738
9 SASI_Mm02_00339608 predicted 3080
10 SASI_Mm01_00139456 predicted 2829
11 SASI_Mm01_00139447 predicted 2121
12 SASI_Mm01_00139452 predicted 2936
13 SASI_Mm01_00139453 predicted 3389
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138305
ADCY3 MISSION shRNA Bacterial Glycerol Stock
adenylate cyclase 3
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138305.3-1633s21c1
Sequence:CCGCTCGAAACCTACCTCATCATTGCTCGAGCAATGATGAGGTAGGTTTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138305.2-3244s1c1
Sequence:CCGGCCAGTCATTCAACAACTTCATCTCGAGATGAAGTTGTTGAATGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138305.2-2081s1c1
Sequence:CCGGGCCATGGTGGAGATACTCATTCTCGAGAATGAGTATCTCCACCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138305.2-1057s1c1
Sequence:CCGGGCAGCAGTTCAATACCATGTACTCGAGTACATGGTATTGAACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138305.2-838s1c1
Sequence:CCGGCCTCTACCTGTGTGCTATCATCTCGAGATGATAGCACACAGGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138305.2-2183s1c1
Sequence:CCGGGCCATCTTTCCCAGGTCATTTCTCGAGAAATGACCTGGGAAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138305
ADCY3 MISSION shRNA shRNA Plasmid DNA
adenylate cyclase 3
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138305.3-1633s21c1
Sequence:CCGCTCGAAACCTACCTCATCATTGCTCGAGCAATGATGAGGTAGGTTTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138305.2-3244s1c1
Sequence:CCGGCCAGTCATTCAACAACTTCATCTCGAGATGAAGTTGTTGAATGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138305.2-2081s1c1
Sequence:CCGGGCCATGGTGGAGATACTCATTCTCGAGAATGAGTATCTCCACCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138305.2-1057s1c1
Sequence:CCGGGCAGCAGTTCAATACCATGTACTCGAGTACATGGTATTGAACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138305.2-838s1c1
Sequence:CCGGCCTCTACCTGTGTGCTATCATCTCGAGATGATAGCACACAGGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138305.2-2183s1c1
Sequence:CCGGGCCATCTTTCCCAGGTCATTTCTCGAGAAATGACCTGGGAAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138305
ADCY3 MISSION shRNA Lentiviral Transduction Particles
adenylate cyclase 3
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138305.3-1633s21c1
Sequence:CCGCTCGAAACCTACCTCATCATTGCTCGAGCAATGATGAGGTAGGTTTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138305.2-3244s1c1
Sequence:CCGGCCAGTCATTCAACAACTTCATCTCGAGATGAAGTTGTTGAATGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138305.2-2081s1c1
Sequence:CCGGGCCATGGTGGAGATACTCATTCTCGAGAATGAGTATCTCCACCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138305.2-1057s1c1
Sequence:CCGGGCAGCAGTTCAATACCATGTACTCGAGTACATGGTATTGAACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138305.2-838s1c1
Sequence:CCGGCCTCTACCTGTGTGCTATCATCTCGAGATGATAGCACACAGGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138305.2-2183s1c1
Sequence:CCGGGCCATCTTTCCCAGGTCATTTCTCGAGAAATGACCTGGGAAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004036
ADCY3 MISSION shRNA Bacterial Glycerol Stock
adenylate cyclase 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004036.3-1641s21c1
Sequence:CCGGACCTAGAAGAGAAGGGTATTGCTCGAGCAATACCCTTCTCTTCTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004036.3-1990s21c1
Sequence:CCGGAGAGTCCGCCCAAGTAGTAAACTCGAGTTTACTACTTGGGCGGACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004036.3-2705s21c1
Sequence:CCGGGTGCCTTCCAAGTACTCTATGCTCGAGCATAGAGTACTTGGAAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004036.2-4095s1c1
Sequence:CCGGCCCTTAGTCATGAGAACAGAACTCGAGTTCTGTTCTCATGACTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004036.2-2990s1c1
Sequence:CCGGGTCTGCGTTTCCTCAATGAAACTCGAGTTTCATTGAGGAAACGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004036.2-1062s1c1
Sequence:CCGGGCAGTTCAACACCATGTACATCTCGAGATGTACATGGTGTTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004036.2-2532s1c1
Sequence:CCGGGCGTCCCGTCTTTGATGAATACTCGAGTATTCATCAAAGACGGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004036.2-2110s1c1
Sequence:CCGGCCCTGGCTAATGACAAACTATCTCGAGATAGTTTGTCATTAGCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004036
ADCY3 MISSION shRNA shRNA Plasmid DNA
adenylate cyclase 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004036.3-1641s21c1
Sequence:CCGGACCTAGAAGAGAAGGGTATTGCTCGAGCAATACCCTTCTCTTCTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004036.3-1990s21c1
Sequence:CCGGAGAGTCCGCCCAAGTAGTAAACTCGAGTTTACTACTTGGGCGGACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004036.3-2705s21c1
Sequence:CCGGGTGCCTTCCAAGTACTCTATGCTCGAGCATAGAGTACTTGGAAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004036.2-4095s1c1
Sequence:CCGGCCCTTAGTCATGAGAACAGAACTCGAGTTCTGTTCTCATGACTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004036.2-2990s1c1
Sequence:CCGGGTCTGCGTTTCCTCAATGAAACTCGAGTTTCATTGAGGAAACGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004036.2-1062s1c1
Sequence:CCGGGCAGTTCAACACCATGTACATCTCGAGATGTACATGGTGTTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004036.2-2532s1c1
Sequence:CCGGGCGTCCCGTCTTTGATGAATACTCGAGTATTCATCAAAGACGGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004036.2-2110s1c1
Sequence:CCGGCCCTGGCTAATGACAAACTATCTCGAGATAGTTTGTCATTAGCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004036
ADCY3 MISSION shRNA Lentiviral Transduction Particles
adenylate cyclase 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004036.3-1641s21c1
Sequence:CCGGACCTAGAAGAGAAGGGTATTGCTCGAGCAATACCCTTCTCTTCTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004036.3-1990s21c1
Sequence:CCGGAGAGTCCGCCCAAGTAGTAAACTCGAGTTTACTACTTGGGCGGACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004036.3-2705s21c1
Sequence:CCGGGTGCCTTCCAAGTACTCTATGCTCGAGCATAGAGTACTTGGAAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004036.2-4095s1c1
Sequence:CCGGCCCTTAGTCATGAGAACAGAACTCGAGTTCTGTTCTCATGACTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004036.2-2990s1c1
Sequence:CCGGGTCTGCGTTTCCTCAATGAAACTCGAGTTTCATTGAGGAAACGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004036.2-1062s1c1
Sequence:CCGGGCAGTTCAACACCATGTACATCTCGAGATGTACATGGTGTTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004036.2-2532s1c1
Sequence:CCGGGCGTCCCGTCTTTGATGAATACTCGAGTATTCATCAAAGACGGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004036.2-2110s1c1
Sequence:CCGGCCCTGGCTAATGACAAACTATCTCGAGATAGTTTGTCATTAGCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks