EMAIL THIS PAGE TO A FRIEND

ADCY4

adenylate cyclase 4

51 Gene Product Result for
Synonyms: AC4
UniProtKB ID: Q8NFM4, B3KV74, D3DS75, Q17R40, Q96ML7
Gene ID:
Human(196883) Summary: This gene encodes a member of the family of adenylate cyclases, which are membrane-associated enzymes that catalyze the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). Mouse studies show that adenylate cyclase 4, along with adenylate cyclases 2 and 3, is expressed in olfactory cilia, suggesting that several different adenylate cyclases may couple to olfactory receptors and that there may be multiple receptor-mediated mechanisms for the generation of cAMP signals. Alternative splicing results in transcript variants. [provided by RefSeq, Nov 2010]
Mouse(104110) adenylate cyclase 4
Rat(54223) adenylate cyclase 4
domestic cat(101097735) adenylate cyclase 4
cow(788151) adenylate cyclase 4
Horse(100054305) adenylate cyclase 4
dog(480271) adenylate cyclase 4
naked mole-rat(101719464) adenylate cyclase 4
domestic guinea pig(100715532) adenylate cyclase 4
sheep(101119139) adenylate cyclase 4
Domestic Rabbit(100346742) adenylate cyclase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
S153 SQ 22,536 ≥97% (HPLC), powder human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080435 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080435 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080435 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_139247 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139247 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139247 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU031311 MISSION® esiRNA esiRNA human ADCY4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139247 Rosetta Predictions human pricing
NM_019285 Rosetta Predictions rat pricing
NM_080435 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139247 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078078 predicted 2035
2 SASI_Hs01_00078079 predicted 2142
3 SASI_Hs01_00078080 predicted 2961
4 SASI_Hs01_00078081 predicted 2206
5 SASI_Hs01_00078082 predicted 1647
6 SASI_Hs01_00078083 predicted 876
7 SASI_Hs01_00078084 predicted 2910
8 SASI_Hs01_00078085 predicted 2093
9 SASI_Hs01_00078086 predicted 937
10 SASI_Hs01_00078087 predicted 2710
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019285 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071879 predicted 2783
2 SASI_Rn01_00071880 predicted 1044
3 SASI_Rn02_00262215 predicted 2707
4 SASI_Rn01_00071883 predicted 2502
5 SASI_Rn01_00071884 predicted 2341
6 SASI_Rn02_00262216 predicted 224
7 SASI_Rn01_00071885 predicted 318
8 SASI_Rn01_00071886 predicted 1557
9 SASI_Rn01_00071887 predicted 2441
10 SASI_Rn01_00071888 predicted 2181
11 SASI_Rn01_00071881 predicted 3074
12 SASI_Rn01_00071882 predicted 883
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080435 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138171 predicted 2180
2 SASI_Mm01_00138172 predicted 1927
3 SASI_Mm01_00138173 predicted 2605
4 SASI_Mm01_00138174 predicted 2322
5 SASI_Mm01_00138175 predicted 386
6 SASI_Mm01_00138176 predicted 286
7 SASI_Mm01_00138178 predicted 3074
8 SASI_Mm01_00138179 predicted 2207
9 SASI_Mm02_00338088 predicted 2144
10 SASI_Mm02_00338089 predicted 641
11 SASI_Mm01_00138177 predicted 2375
12 SASI_Mm01_00138180 predicted 2380
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080435
ADCY4 MISSION shRNA Bacterial Glycerol Stock
adenylate cyclase 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080435.1-1738s1c1
Sequence:CCGGCGAACAACTCAACTCTCAGAACTCGAGTTCTGAGAGTTGAGTTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080435.1-2119s1c1
Sequence:CCGGCCTGGTATTCACTATGGCCATCTCGAGATGGCCATAGTGAATACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080435.1-1436s1c1
Sequence:CCGGCCTACATACCTGGTCATTGATCTCGAGATCAATGACCAGGTATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080435.1-2725s1c1
Sequence:CCGGCGAATGCGTTTGTGTCCTCTTCTCGAGAAGAGGACACAAACGCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080435.1-380s1c1
Sequence:CCGGCGACCTCTTTCTGGTCTCATACTCGAGTATGAGACCAGAAAGAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080435.1-1113s21c1
Sequence:CCGGTGCCTGACCACGCTATCAATTCTCGAGAATTGATAGCGTGGTCAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080435.1-631s21c1
Sequence:CCGGGTTGGCAGCAAACGCGGTATTCTCGAGAATACCGCGTTTGCTGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080435.1-3037s21c1
Sequence:CCGGCAACAAGCACTCGTTCAATAACTCGAGTTATTGAACGAGTGCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080435
ADCY4 MISSION shRNA shRNA Plasmid DNA
adenylate cyclase 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080435.1-1738s1c1
Sequence:CCGGCGAACAACTCAACTCTCAGAACTCGAGTTCTGAGAGTTGAGTTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080435.1-2119s1c1
Sequence:CCGGCCTGGTATTCACTATGGCCATCTCGAGATGGCCATAGTGAATACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080435.1-1436s1c1
Sequence:CCGGCCTACATACCTGGTCATTGATCTCGAGATCAATGACCAGGTATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080435.1-2725s1c1
Sequence:CCGGCGAATGCGTTTGTGTCCTCTTCTCGAGAAGAGGACACAAACGCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080435.1-380s1c1
Sequence:CCGGCGACCTCTTTCTGGTCTCATACTCGAGTATGAGACCAGAAAGAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080435.1-1113s21c1
Sequence:CCGGTGCCTGACCACGCTATCAATTCTCGAGAATTGATAGCGTGGTCAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080435.1-631s21c1
Sequence:CCGGGTTGGCAGCAAACGCGGTATTCTCGAGAATACCGCGTTTGCTGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080435.1-3037s21c1
Sequence:CCGGCAACAAGCACTCGTTCAATAACTCGAGTTATTGAACGAGTGCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080435
ADCY4 MISSION shRNA Lentiviral Transduction Particles
adenylate cyclase 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080435.1-1738s1c1
Sequence:CCGGCGAACAACTCAACTCTCAGAACTCGAGTTCTGAGAGTTGAGTTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080435.1-2119s1c1
Sequence:CCGGCCTGGTATTCACTATGGCCATCTCGAGATGGCCATAGTGAATACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080435.1-1436s1c1
Sequence:CCGGCCTACATACCTGGTCATTGATCTCGAGATCAATGACCAGGTATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080435.1-2725s1c1
Sequence:CCGGCGAATGCGTTTGTGTCCTCTTCTCGAGAAGAGGACACAAACGCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080435.1-380s1c1
Sequence:CCGGCGACCTCTTTCTGGTCTCATACTCGAGTATGAGACCAGAAAGAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080435.1-1113s21c1
Sequence:CCGGTGCCTGACCACGCTATCAATTCTCGAGAATTGATAGCGTGGTCAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080435.1-631s21c1
Sequence:CCGGGTTGGCAGCAAACGCGGTATTCTCGAGAATACCGCGTTTGCTGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080435.1-3037s21c1
Sequence:CCGGCAACAAGCACTCGTTCAATAACTCGAGTTATTGAACGAGTGCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139247
VALIDATED
ADCY4 MISSION shRNA Bacterial Glycerol Stock
adenylate cyclase 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139247.2-1750s1c1
Sequence:CCGGCCCGCCTTCAAATACTATGAACTCGAGTTCATAGTATTTGAAGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139247.2-2871s1c1
Sequence:CCGGCCTTGGCACTATGGTGGAATTCTCGAGAATTCCACCATAGTGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139247.2-1330s1c1
Sequence:CCGGCCTACCTATCTGGTCATCGATCTCGAGATCGATGACCAGATAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139247.2-768s1c1
Sequence:CCGGGCCAGAGAGCACTAACAATTTCTCGAGAAATTGTTAGTGCTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139247.2-2919s1c1
Sequence:CCGGCGTCATCAACAAGCATTCATTCTCGAGAATGAATGCTTGTTGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139247.2-1643s21c1
Sequence:CCGGAGCAGCTCAACTCGCAGAAACCTCGAGGTTTCTGCGAGTTGAGCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139247.2-2704s21c1
Sequence:CCGGAGGCTGCTCAATGAGATAATTCTCGAGAATTATCTCATTGAGCAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139247.2-2978s21c1
Sequence:CCGGCCGTAGTAGCTGGAGTTATTGCTCGAGCAATAACTCCAGCTACTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139247
VALIDATED
ADCY4 MISSION shRNA shRNA Plasmid DNA
adenylate cyclase 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139247.2-1750s1c1
Sequence:CCGGCCCGCCTTCAAATACTATGAACTCGAGTTCATAGTATTTGAAGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139247.2-2871s1c1
Sequence:CCGGCCTTGGCACTATGGTGGAATTCTCGAGAATTCCACCATAGTGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139247.2-1330s1c1
Sequence:CCGGCCTACCTATCTGGTCATCGATCTCGAGATCGATGACCAGATAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139247.2-768s1c1
Sequence:CCGGGCCAGAGAGCACTAACAATTTCTCGAGAAATTGTTAGTGCTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139247.2-2919s1c1
Sequence:CCGGCGTCATCAACAAGCATTCATTCTCGAGAATGAATGCTTGTTGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139247.2-1643s21c1
Sequence:CCGGAGCAGCTCAACTCGCAGAAACCTCGAGGTTTCTGCGAGTTGAGCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139247.2-2704s21c1
Sequence:CCGGAGGCTGCTCAATGAGATAATTCTCGAGAATTATCTCATTGAGCAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139247.2-2978s21c1
Sequence:CCGGCCGTAGTAGCTGGAGTTATTGCTCGAGCAATAACTCCAGCTACTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139247
VALIDATED
ADCY4 MISSION shRNA Lentiviral Transduction Particles
adenylate cyclase 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139247.2-1750s1c1
Sequence:CCGGCCCGCCTTCAAATACTATGAACTCGAGTTCATAGTATTTGAAGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139247.2-2871s1c1
Sequence:CCGGCCTTGGCACTATGGTGGAATTCTCGAGAATTCCACCATAGTGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139247.2-1330s1c1
Sequence:CCGGCCTACCTATCTGGTCATCGATCTCGAGATCGATGACCAGATAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139247.2-768s1c1
Sequence:CCGGGCCAGAGAGCACTAACAATTTCTCGAGAAATTGTTAGTGCTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139247.2-2919s1c1
Sequence:CCGGCGTCATCAACAAGCATTCATTCTCGAGAATGAATGCTTGTTGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139247.2-1643s21c1
Sequence:CCGGAGCAGCTCAACTCGCAGAAACCTCGAGGTTTCTGCGAGTTGAGCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139247.2-2704s21c1
Sequence:CCGGAGGCTGCTCAATGAGATAATTCTCGAGAATTATCTCATTGAGCAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139247.2-2978s21c1
Sequence:CCGGCCGTAGTAGCTGGAGTTATTGCTCGAGCAATAACTCCAGCTACTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks