EMAIL THIS PAGE TO A FRIEND

ADCY5

adenylate cyclase 5

Synonyms: AC5 FDFM
UniProtKB ID: O95622, B7Z8A6, Q7RTV7, Q8NFM3
Gene ID:
Human(111) Summary: This gene encodes a member of the membrane-bound adenylyl cyclase enzymes. Adenylyl cyclases mediate G protein-coupled receptor signaling through the synthesis of the second messenger cAMP. Activity of the encoded protein is stimulated by the Gs alpha subunit of G protein-coupled receptors and is inhibited by protein kinase A, calcium and Gi alpha subunits. Single nucleotide polymorphisms in this gene may be associated with low birth weight and type 2 diabetes. Alternatively spliced transcript variants that encode different isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
Mouse(224129) adenylate cyclase 5
Rat(64532) adenylate cyclase 5
sheep(101119873) adenylate cyclase 5
Domestic Rabbit(100009315) adenylate cyclase 5
domestic guinea pig(100714732) adenylate cyclase 5
naked mole-rat(101702436) adenylate cyclase 5
Zebrafish(562619) adenylate cyclase 5
dog(403859) adenylate cyclase 5
Horse(100070498) adenylate cyclase 5
cow(505740) adenylate cyclase 5
domestic cat(101100749) adenylate cyclase 5
chicken(395340) adenylate cyclase 5
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
S153 SQ 22,536 ≥97% (HPLC), powder human, rat pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0743 AQUA Peptide VHCGVLGL[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183357 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_183357 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_183357 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001012765 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001012765 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001012765 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_183357 Rosetta Predictions human pricing
NM_022600 Rosetta Predictions rat pricing
NM_001012765 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183357 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172113 predicted 2353
2 SASI_Hs01_00172114 predicted 2964
3 SASI_Hs01_00172115 predicted 987
4 SASI_Hs01_00172116 predicted 2767
5 SASI_Hs01_00172117 predicted 2071
6 SASI_Hs01_00172118 predicted 2975
7 SASI_Hs01_00172119 predicted 2147
8 SASI_Hs01_00172121 predicted 2889
9 SASI_Hs01_00172122 predicted 3256
10 SASI_Hs02_00371271 predicted 1517
11 SASI_Hs01_00172120 predicted 3521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022600 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040479 predicted 1792
2 SASI_Rn01_00040480 predicted 2802
3 SASI_Rn01_00040481 predicted 3911
4 SASI_Rn01_00040482 predicted 1129
5 SASI_Rn01_00040483 predicted 1069
6 SASI_Rn01_00040484 predicted 1947
7 SASI_Rn01_00040485 predicted 2638
8 SASI_Rn01_00040486 predicted 3211
9 SASI_Rn01_00040487 predicted 3256
10 SASI_Rn01_00040488 predicted 2168
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012765 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080835 predicted 1814
2 SASI_Mm01_00080836 predicted 2446
3 SASI_Mm02_00287135 predicted 1147
4 SASI_Mm01_00080837 predicted 3934
5 SASI_Mm01_00080838 predicted 3730
6 SASI_Mm01_00080839 predicted 4112
7 SASI_Mm01_00080840 predicted 3272
8 SASI_Mm01_00080841 predicted 3983
9 SASI_Mm01_00080842 predicted 1965
10 SASI_Mm01_00080843 predicted 3907
11 SASI_Mm01_00080844 predicted 2968
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183357
ADCY5 MISSION shRNA Bacterial Glycerol Stock
adenylate cyclase 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183357.1-656s21c1
Sequence:CCGGAGAAGTTCCCGTCGGACAAACCTCGAGGTTTGTCCGACGGGAACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183357.1-2264s21c1
Sequence:CCGGAGCAGGTAGACGACCGATTTGCTCGAGCAAATCGGTCGTCTACCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183357.1-1136s21c1
Sequence:CCGGTTGTCTCCAATGTTCTCATTTCTCGAGAAATGAGAACATTGGAGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183357.1-2895s1c1
Sequence:CCGGCGCCATAGACTTCTTCAACAACTCGAGTTGTTGAAGAAGTCTATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183357.1-2419s1c1
Sequence:CCGGTCTGTGATCTACTCCTGCGTACTCGAGTACGCAGGAGTAGATCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183357.1-2892s1c1
Sequence:CCGGCAACGCCATAGACTTCTTCAACTCGAGTTGAAGAAGTCTATGGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183357.1-1825s1c1
Sequence:CCGGGCTACACTCAACTACCTGAATCTCGAGATTCAGGTAGTTGAGTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183357.1-1513s1c1
Sequence:CCGGGCCGCAGAGAATCACTGTTTACTCGAGTAAACAGTGATTCTCTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183357
ADCY5 MISSION shRNA shRNA Plasmid DNA
adenylate cyclase 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183357.1-656s21c1
Sequence:CCGGAGAAGTTCCCGTCGGACAAACCTCGAGGTTTGTCCGACGGGAACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183357.1-2264s21c1
Sequence:CCGGAGCAGGTAGACGACCGATTTGCTCGAGCAAATCGGTCGTCTACCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183357.1-1136s21c1
Sequence:CCGGTTGTCTCCAATGTTCTCATTTCTCGAGAAATGAGAACATTGGAGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183357.1-2895s1c1
Sequence:CCGGCGCCATAGACTTCTTCAACAACTCGAGTTGTTGAAGAAGTCTATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183357.1-2419s1c1
Sequence:CCGGTCTGTGATCTACTCCTGCGTACTCGAGTACGCAGGAGTAGATCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183357.1-2892s1c1
Sequence:CCGGCAACGCCATAGACTTCTTCAACTCGAGTTGAAGAAGTCTATGGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183357.1-1825s1c1
Sequence:CCGGGCTACACTCAACTACCTGAATCTCGAGATTCAGGTAGTTGAGTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183357.1-1513s1c1
Sequence:CCGGGCCGCAGAGAATCACTGTTTACTCGAGTAAACAGTGATTCTCTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183357
ADCY5 MISSION shRNA Lentiviral Transduction Particles
adenylate cyclase 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183357.1-656s21c1
Sequence:CCGGAGAAGTTCCCGTCGGACAAACCTCGAGGTTTGTCCGACGGGAACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183357.1-2264s21c1
Sequence:CCGGAGCAGGTAGACGACCGATTTGCTCGAGCAAATCGGTCGTCTACCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183357.1-1136s21c1
Sequence:CCGGTTGTCTCCAATGTTCTCATTTCTCGAGAAATGAGAACATTGGAGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183357.1-2895s1c1
Sequence:CCGGCGCCATAGACTTCTTCAACAACTCGAGTTGTTGAAGAAGTCTATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183357.1-2419s1c1
Sequence:CCGGTCTGTGATCTACTCCTGCGTACTCGAGTACGCAGGAGTAGATCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183357.1-2892s1c1
Sequence:CCGGCAACGCCATAGACTTCTTCAACTCGAGTTGAAGAAGTCTATGGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183357.1-1825s1c1
Sequence:CCGGGCTACACTCAACTACCTGAATCTCGAGATTCAGGTAGTTGAGTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183357.1-1513s1c1
Sequence:CCGGGCCGCAGAGAATCACTGTTTACTCGAGTAAACAGTGATTCTCTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012765
ADCY5 MISSION shRNA Bacterial Glycerol Stock
adenylate cyclase 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012765.1-3855s1c1
Sequence:CCGGCCAGGTTACTACAGATATGTACTCGAGTACATATCTGTAGTAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012765.1-1721s1c1
Sequence:CCGGAGAATCACTGTTTACGGATTACTCGAGTAATCCGTAAACAGTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012765.1-3720s1c1
Sequence:CCGGCCAGATGAAGATTGGGCTCAACTCGAGTTGAGCCCAATCTTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012765.1-837s1c1
Sequence:CCGGGCTGCAGATATTCCGCTCTAACTCGAGTTAGAGCGGAATATCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012765.1-2026s1c1
Sequence:CCGGGCCACACTCAACTACCTGAATCTCGAGATTCAGGTAGTTGAGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012765
ADCY5 MISSION shRNA shRNA Plasmid DNA
adenylate cyclase 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012765.1-3855s1c1
Sequence:CCGGCCAGGTTACTACAGATATGTACTCGAGTACATATCTGTAGTAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012765.1-1721s1c1
Sequence:CCGGAGAATCACTGTTTACGGATTACTCGAGTAATCCGTAAACAGTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012765.1-3720s1c1
Sequence:CCGGCCAGATGAAGATTGGGCTCAACTCGAGTTGAGCCCAATCTTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012765.1-837s1c1
Sequence:CCGGGCTGCAGATATTCCGCTCTAACTCGAGTTAGAGCGGAATATCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012765.1-2026s1c1
Sequence:CCGGGCCACACTCAACTACCTGAATCTCGAGATTCAGGTAGTTGAGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012765
ADCY5 MISSION shRNA Lentiviral Transduction Particles
adenylate cyclase 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012765.1-3855s1c1
Sequence:CCGGCCAGGTTACTACAGATATGTACTCGAGTACATATCTGTAGTAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012765.1-1721s1c1
Sequence:CCGGAGAATCACTGTTTACGGATTACTCGAGTAATCCGTAAACAGTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012765.1-3720s1c1
Sequence:CCGGCCAGATGAAGATTGGGCTCAACTCGAGTTGAGCCCAATCTTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012765.1-837s1c1
Sequence:CCGGGCTGCAGATATTCCGCTCTAACTCGAGTTAGAGCGGAATATCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012765.1-2026s1c1
Sequence:CCGGGCCACACTCAACTACCTGAATCTCGAGATTCAGGTAGTTGAGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks