EMAIL THIS PAGE TO A FRIEND

ADCY6

adenylate cyclase 6

226 Gene Product Result for
Synonyms: AC6
UniProtKB ID: O43306, Q9NR75, Q9UDB0
Gene ID:
Human(112) Summary: This gene encodes adenylate cyclase 6, which is a membrane-associated enzyme and catalyzes the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). The expression of this gene is found in normal thyroid and brain tissues, as well as some tumors; and its expression is significantly higher in one hyperfunctioning thyroid tumor than in normal thyroid tissue. Alternative splicing generates 2 transcript variants. [provided by RefSeq, Jul 2008]
Mouse(11512) adenylate cyclase 6
Rat(25289) adenylate cyclase 6
cow(509936) adenylate cyclase 6
Horse(100051295) adenylate cyclase 6
domestic cat(101091211) adenylate cyclase 6
dog(477625) adenylate cyclase 6
naked mole-rat(101698189) adenylate cyclase 6
domestic guinea pig(100731224) adenylate cyclase 6
sheep(101105735) adenylate cyclase 6
Domestic Rabbit(100354934) adenylate cyclase 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500206 Anti-ADCY5, C-Terminal antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry pricing
GW21024 Anti-ADCY6 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB2100054 Anti-ADCY6 antibody produced in rabbit affinity isolated antibody rat, human, horse, rabbit, canine, bovine, mouse
western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
S153 SQ 22,536 ≥97% (HPLC), powder human, rat pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0743 AQUA Peptide VHCGVLGL[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007405 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007405 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007405 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015270 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015270 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015270 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015270 Rosetta Predictions human pricing
NM_020983 Rosetta Predictions human pricing
NM_012821 Rosetta Predictions rat pricing
NM_007405 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015270 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075394 predicted 3990
2 SASI_Hs01_00075395 predicted 1770
3 SASI_Hs01_00075396 predicted 1749
4 SASI_Hs01_00075397 predicted 2293
5 SASI_Hs01_00075398 predicted 2545
6 SASI_Hs01_00075399 predicted 2129
7 SASI_Hs01_00075400 predicted 2561
8 SASI_Hs01_00075401 predicted 3640
9 SASI_Hs01_00075402 predicted 3830
10 SASI_Hs01_00075403 predicted 1569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020983 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087449 predicted 3305
2 SASI_Hs01_00087450 predicted 1239
3 SASI_Hs01_00087451 predicted 1221
4 SASI_Hs01_00087452 predicted 1762
5 SASI_Hs01_00087453 predicted 2024
6 SASI_Hs01_00087454 predicted 1603
7 SASI_Hs01_00087455 predicted 2038
8 SASI_Hs01_00087456 predicted 2964
9 SASI_Hs01_00087457 predicted 3153
10 SASI_Hs01_00087458 predicted 1050
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012821 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112751 predicted 1992
2 SASI_Rn01_00112753 predicted 935
3 SASI_Rn01_00112754 predicted 2284
4 SASI_Rn01_00112755 predicted 3513
5 SASI_Rn01_00112756 predicted 2878
6 SASI_Rn01_00112757 predicted 3441
7 SASI_Rn01_00112758 predicted 2776
8 SASI_Rn01_00112760 predicted 602
9 SASI_Rn02_00260273 predicted 3174
10 SASI_Rn02_00260274 predicted 2027
11 SASI_Rn01_00112752 predicted 3401
12 SASI_Rn01_00112759 predicted 2920
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007405 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031173 predicted 2119
2 SASI_Mm02_00311532 predicted 3103
3 SASI_Mm01_00031174 predicted 3483
4 SASI_Mm01_00031175 predicted 3409
5 SASI_Mm01_00031176 predicted 3068
6 SASI_Mm01_00031177 predicted 938
7 SASI_Mm01_00031178 predicted 3328
8 SASI_Mm01_00031179 predicted 3277
9 SASI_Mm01_00031180 predicted 1961
10 SASI_Mm01_00031181 predicted 1993
11 SASI_Mm01_00031182 predicted 780
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007405
VALIDATED
ADCY6 MISSION shRNA Bacterial Glycerol Stock
adenylate cyclase 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110755    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007405.1-3870s1c1
Sequence:CCGGGCCTCCTGTTTGAGAGTTAAACTCGAGTTTAACTCTCAAACAGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007405.1-3041s1c1
Sequence:CCGGCGCCAATTTCTCGGAGTTCTACTCGAGTAGAACTCCGAGAAATTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007405.1-2360s1c1
Sequence:CCGGCGCCAACATGTTTACCTGTAACTCGAGTTACAGGTAAACATGTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007405.1-3416s1c1
Sequence:CCGGCGTGAATGTTTCCAGTCGTATCTCGAGATACGACTGGAAACATTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007405.1-2446s1c1
Sequence:CCGGGCCACCTACAACAGCTCAATTCTCGAGAATTGAGCTGTTGTAGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007405.2-2339s21c1
Sequence:CCGGCAACGCCTGTCCCGCAATATTCTCGAGAATATTGCGGGACAGGCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007405.2-3940s21c1
Sequence:CCGGGCCTCCTGTTTGAGAGTTAAACTCGAGTTTAACTCTCAAACAGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007405.2-3109s21c1
Sequence:CCGGCGCCAATTTCTCGGAGTTCTACTCGAGTAGAACTCCGAGAAATTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007405.2-2428s21c1
Sequence:CCGGCGCCAACATGTTTACCTGTAACTCGAGTTACAGGTAAACATGTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007405.2-2236s21c1
Sequence:CCGGCACCCTGATACTCGGGATTTACTCGAGTAAATCCCGAGTATCAGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007405
VALIDATED
ADCY6 MISSION shRNA shRNA Plasmid DNA
adenylate cyclase 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110755    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007405.1-3870s1c1
Sequence:CCGGGCCTCCTGTTTGAGAGTTAAACTCGAGTTTAACTCTCAAACAGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007405.1-3041s1c1
Sequence:CCGGCGCCAATTTCTCGGAGTTCTACTCGAGTAGAACTCCGAGAAATTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007405.1-2360s1c1
Sequence:CCGGCGCCAACATGTTTACCTGTAACTCGAGTTACAGGTAAACATGTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007405.1-3416s1c1
Sequence:CCGGCGTGAATGTTTCCAGTCGTATCTCGAGATACGACTGGAAACATTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007405.1-2446s1c1
Sequence:CCGGGCCACCTACAACAGCTCAATTCTCGAGAATTGAGCTGTTGTAGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007405.2-2339s21c1
Sequence:CCGGCAACGCCTGTCCCGCAATATTCTCGAGAATATTGCGGGACAGGCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007405.2-3940s21c1
Sequence:CCGGGCCTCCTGTTTGAGAGTTAAACTCGAGTTTAACTCTCAAACAGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007405.2-3109s21c1
Sequence:CCGGCGCCAATTTCTCGGAGTTCTACTCGAGTAGAACTCCGAGAAATTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007405.2-2428s21c1
Sequence:CCGGCGCCAACATGTTTACCTGTAACTCGAGTTACAGGTAAACATGTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007405.2-2236s21c1
Sequence:CCGGCACCCTGATACTCGGGATTTACTCGAGTAAATCCCGAGTATCAGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007405
VALIDATED
ADCY6 MISSION shRNA Lentiviral Transduction Particles
adenylate cyclase 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110755    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007405.1-3870s1c1
Sequence:CCGGGCCTCCTGTTTGAGAGTTAAACTCGAGTTTAACTCTCAAACAGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007405.1-3041s1c1
Sequence:CCGGCGCCAATTTCTCGGAGTTCTACTCGAGTAGAACTCCGAGAAATTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007405.1-2360s1c1
Sequence:CCGGCGCCAACATGTTTACCTGTAACTCGAGTTACAGGTAAACATGTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007405.1-3416s1c1
Sequence:CCGGCGTGAATGTTTCCAGTCGTATCTCGAGATACGACTGGAAACATTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007405.1-2446s1c1
Sequence:CCGGGCCACCTACAACAGCTCAATTCTCGAGAATTGAGCTGTTGTAGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007405.2-2339s21c1
Sequence:CCGGCAACGCCTGTCCCGCAATATTCTCGAGAATATTGCGGGACAGGCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007405.2-3940s21c1
Sequence:CCGGGCCTCCTGTTTGAGAGTTAAACTCGAGTTTAACTCTCAAACAGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007405.2-3109s21c1
Sequence:CCGGCGCCAATTTCTCGGAGTTCTACTCGAGTAGAACTCCGAGAAATTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007405.2-2428s21c1
Sequence:CCGGCGCCAACATGTTTACCTGTAACTCGAGTTACAGGTAAACATGTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007405.2-2236s21c1
Sequence:CCGGCACCCTGATACTCGGGATTTACTCGAGTAAATCCCGAGTATCAGGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015270
ADCY6 MISSION shRNA Bacterial Glycerol Stock
adenylate cyclase 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015270.2-4781s1c1
Sequence:CCGGGCCATATTTCAGGAGAATGTTCTCGAGAACATTCTCCTGAAATATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015270.2-3629s1c1
Sequence:CCGGGCTGTTATGTTTGCCTCCATTCTCGAGAATGGAGGCAAACATAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015270.2-3317s1c1
Sequence:CCGGGCTTCTTCCAATGAGACCTTTCTCGAGAAAGGTCTCATTGGAAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015270.2-1417s1c1
Sequence:CCGGCCCTGTGTTCTTTGTCTACATCTCGAGATGTAGACAAAGAACACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015270.2-2940s1c2
Sequence:CCGGCCGTCCTGCTTGTGTTTACTTCTCGAGAAGTAAACACAAGCAGGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015270
ADCY6 MISSION shRNA shRNA Plasmid DNA
adenylate cyclase 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015270.2-4781s1c1
Sequence:CCGGGCCATATTTCAGGAGAATGTTCTCGAGAACATTCTCCTGAAATATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015270.2-3629s1c1
Sequence:CCGGGCTGTTATGTTTGCCTCCATTCTCGAGAATGGAGGCAAACATAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015270.2-3317s1c1
Sequence:CCGGGCTTCTTCCAATGAGACCTTTCTCGAGAAAGGTCTCATTGGAAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015270.2-1417s1c1
Sequence:CCGGCCCTGTGTTCTTTGTCTACATCTCGAGATGTAGACAAAGAACACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015270.2-2940s1c2
Sequence:CCGGCCGTCCTGCTTGTGTTTACTTCTCGAGAAGTAAACACAAGCAGGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015270
ADCY6 MISSION shRNA Lentiviral Transduction Particles
adenylate cyclase 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015270.2-4781s1c1
Sequence:CCGGGCCATATTTCAGGAGAATGTTCTCGAGAACATTCTCCTGAAATATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015270.2-3629s1c1
Sequence:CCGGGCTGTTATGTTTGCCTCCATTCTCGAGAATGGAGGCAAACATAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015270.2-3317s1c1
Sequence:CCGGGCTTCTTCCAATGAGACCTTTCTCGAGAAAGGTCTCATTGGAAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015270.2-1417s1c1
Sequence:CCGGCCCTGTGTTCTTTGTCTACATCTCGAGATGTAGACAAAGAACACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015270.2-2940s1c2
Sequence:CCGGCCGTCCTGCTTGTGTTTACTTCTCGAGAAGTAAACACAAGCAGGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)