EMAIL THIS PAGE TO A FRIEND

ADCY7

adenylate cyclase 7

142 Gene Product Result for
Synonyms: AC7
UniProtKB ID: P51828, A0AVA6
Gene ID:
Human(113) Summary: This gene encodes a membrane-bound adenylate cyclase that catalyses the formation of cyclic AMP from ATP and is inhibitable by calcium. The product of this gene is a member of the adenylyl cyclase class-4/guanylyl cyclase enzyme family that is characterized by the presence of twelve membrane-spanning domains in its sequences. [provided by RefSeq, Jul 2008]
Mouse(11513) adenylate cyclase 7
Rat(84420) adenylate cyclase 7
Zebrafish(568726) adenylate cyclase 7
dog(487289) adenylate cyclase 7
cow(281603) adenylate cyclase 7
domestic cat(101094148) adenylate cyclase 7
chicken(415732) adenylate cyclase 7
sheep(101112667) adenylate cyclase 7
Domestic Rabbit(100357357) adenylate cyclase 7
domestic guinea pig(100726699) adenylate cyclase 7
naked mole-rat(101712483) adenylate cyclase 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
S153 SQ 22,536 ≥97% (HPLC), powder human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007406 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007406 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007406 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001114 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001114 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001114 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114 Rosetta Predictions human pricing
XM_001056453 Rosetta Predictions rat pricing
XM_001063157 Rosetta Predictions rat pricing
XM_001063214 Rosetta Predictions rat pricing
XM_226333 Rosetta Predictions rat pricing
NM_001037723 Rosetta Predictions mouse pricing
NM_001037724 Rosetta Predictions mouse pricing
NM_001109756 Rosetta Predictions mouse pricing
NM_007406 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077668 predicted 457
2 SASI_Hs02_00326141 predicted 2698
3 SASI_Hs01_00077670 predicted 3450
4 SASI_Hs01_00077671 predicted 3193
5 SASI_Hs02_00326142 predicted 3026
6 SASI_Hs02_00326143 predicted 869
7 SASI_Hs01_00077672 predicted 1224
8 SASI_Hs01_00077673 predicted 2849
9 SASI_Hs01_00077674 predicted 584
10 SASI_Hs01_00077675 predicted 1961
11 SASI_Hs01_00077669 predicted 317
12 SASI_Hs01_00077676 predicted 3318
13 SASI_Hs01_00077677 predicted 679
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056453 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00283356 predicted 1344
2 SASI_Rn02_00283357 predicted 2592
3 SASI_Rn02_00283358 predicted 2422
4 SASI_Rn02_00283359 predicted 2966
5 SASI_Rn02_00283360 predicted 489
6 SASI_Rn02_00283361 predicted 777
7 SASI_Rn02_00283362 predicted 243
8 SASI_Rn02_00283363 predicted 1068
9 SASI_Rn02_00283364 predicted 1036
10 SASI_Rn02_00283365 predicted 2497
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063157 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00306017 predicted 1339
2 SASI_Rn02_00306018 predicted 2593
3 SASI_Rn02_00306019 predicted 2423
4 SASI_Rn02_00306020 predicted 2962
5 SASI_Rn02_00306021 predicted 488
6 SASI_Rn02_00306022 predicted 782
7 SASI_Rn02_00306023 predicted 243
8 SASI_Rn02_00306024 predicted 1072
9 SASI_Rn02_00306025 predicted 1041
10 SASI_Rn02_00306026 predicted 2494
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063214 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00306267 predicted 1343
2 SASI_Rn02_00306268 predicted 2664
3 SASI_Rn02_00306269 predicted 2494
4 SASI_Rn02_00306270 predicted 3038
5 SASI_Rn02_00306271 predicted 483
6 SASI_Rn02_00306272 predicted 243
7 SASI_Rn02_00306273 predicted 1070
8 SASI_Rn02_00306274 predicted 1039
9 SASI_Rn02_00306275 predicted 2569
10 SASI_Rn02_00306276 predicted 2364
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226333 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383464 predicted 1341
2 SASI_Rn02_00383465 predicted 2663
3 SASI_Rn02_00383466 predicted 2492
4 SASI_Rn02_00383467 predicted 3045
5 SASI_Rn02_00383468 predicted 490
6 SASI_Rn02_00383469 predicted 242
7 SASI_Rn02_00383470 predicted 1075
8 SASI_Rn02_00383471 predicted 1042
9 SASI_Rn02_00383472 predicted 2572
10 SASI_Rn02_00383473 predicted 2359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037723 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289345 predicted 3948
2 SASI_Mm02_00289346 predicted 1333
3 SASI_Mm02_00289347 predicted 1353
4 SASI_Mm02_00289348 predicted 1368
5 SASI_Mm02_00289349 predicted 1544
6 SASI_Mm02_00289350 predicted 3258
7 SASI_Mm02_00289351 predicted 1929
8 SASI_Mm02_00289352 predicted 1609
9 SASI_Mm02_00289353 predicted 1630
10 SASI_Mm02_00289354 predicted 3151
11 SASI_Mm01_00146842 predicted 3762
12 SASI_Mm01_00146843 predicted 2422
13 SASI_Mm01_00146844 predicted 2492
14 SASI_Mm01_00146845 predicted 720
15 SASI_Mm01_00146846 predicted 804
16 SASI_Mm01_00146847 predicted 2434
17 SASI_Mm01_00146848 predicted 3789
18 SASI_Mm01_00146849 predicted 789
19 SASI_Mm01_00146850 predicted 2495
20 SASI_Mm01_00146851 predicted 2406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037724 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289355 predicted 3883
2 SASI_Mm02_00289356 predicted 1264
3 SASI_Mm02_00289357 predicted 1286
4 SASI_Mm02_00289358 predicted 1306
5 SASI_Mm02_00289359 predicted 1478
6 SASI_Mm02_00289360 predicted 3191
7 SASI_Mm02_00289361 predicted 1868
8 SASI_Mm02_00289362 predicted 1552
9 SASI_Mm02_00289363 predicted 1566
10 SASI_Mm02_00289364 predicted 3090
11 SASI_Mm01_00200400 predicted 3679
12 SASI_Mm01_00200401 predicted 2336
13 SASI_Mm01_00200402 predicted 2400
14 SASI_Mm01_00200403 predicted 637
15 SASI_Mm01_00200404 predicted 720
16 SASI_Mm01_00200405 predicted 2356
17 SASI_Mm01_00200406 predicted 3712
18 SASI_Mm01_00200407 predicted 705
19 SASI_Mm01_00200408 predicted 2404
20 SASI_Mm01_00200409 predicted 2318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109756 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304294 predicted 3856
2 SASI_Mm02_00304295 predicted 1234
3 SASI_Mm02_00304296 predicted 1257
4 SASI_Mm02_00304297 predicted 1271
5 SASI_Mm02_00304298 predicted 1439
6 SASI_Mm02_00304299 predicted 3156
7 SASI_Mm02_00304300 predicted 1834
8 SASI_Mm02_00304301 predicted 1518
9 SASI_Mm02_00304302 predicted 1529
10 SASI_Mm02_00304303 predicted 3062
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007406 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311533 predicted 4035
2 SASI_Mm02_00311534 predicted 1416
3 SASI_Mm02_00311535 predicted 1436
4 SASI_Mm02_00311536 predicted 1452
5 SASI_Mm02_00311537 predicted 1624
6 SASI_Mm02_00311538 predicted 3341
7 SASI_Mm02_00311539 predicted 2017
8 SASI_Mm02_00311540 predicted 1705
9 SASI_Mm02_00311541 predicted 1717
10 SASI_Mm02_00311542 predicted 3240
11 SASI_Mm01_00160005 predicted 3870
12 SASI_Mm01_00160006 predicted 2526
13 SASI_Mm01_00160007 predicted 2584
14 SASI_Mm01_00160008 predicted 813
15 SASI_Mm01_00160009 predicted 897
16 SASI_Mm01_00160010 predicted 2540
17 SASI_Mm01_00160011 predicted 3896
18 SASI_Mm01_00160012 predicted 886
19 SASI_Mm01_00160013 predicted 2585
20 SASI_Mm01_00160014 predicted 2503
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007406
VALIDATED
ADCY7 MISSION shRNA Bacterial Glycerol Stock
adenylate cyclase 7
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007406.2-3886s21c1
Sequence:CCGGGTGGGCTGATCAACGTCAAAGCTCGAGCTTTGACGTTGATCAGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374617    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007406.2-4374s21c1
Sequence:CCGGCAATTAGGCATTCTGGTAAATCTCGAGATTTACCAGAATGCCTAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007406.2-1740s21c1
Sequence:CCGGGACATCTGCGAGGCCATTAAGCTCGAGCTTAATGGCCTCGCAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007406.2-2716s21c1
Sequence:CCGGTACTGACTGTCGCCATCATTACTCGAGTAATGATGGCGACAGTCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007406.2-3616s21c1
Sequence:CCGGTCGGAGTCTTGGTAGAATTTACTCGAGTAAATTCTACCAAGACTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007406.2-1291s21c1
Sequence:CCGGACGCGTCCAGGGATCTCTTTACTCGAGTAAAGAGATCCCTGGACGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114896    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007406.1-4306s1c1
Sequence:CCGGCCAGGCTTATTAGCATGGGTTCTCGAGAACCCATGCTAATAAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007406.1-3117s1c1
Sequence:CCGGCCTGAAGATCATGGTTAACTTCTCGAGAAGTTAACCATGATCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007406.1-3863s1c1
Sequence:CCGGGACTCGGATATTCGTGTGAATCTCGAGATTCACACGAATATCCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007406.1-1926s1c1
Sequence:CCGGGCACATCACAGAGGCAACATTCTCGAGAATGTTGCCTCTGTGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007406.1-1426s1c1
Sequence:CCGGGCCATCATTGAGCGCCTCAAACTCGAGTTTGAGGCGCTCAATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007406
VALIDATED
ADCY7 MISSION shRNA shRNA Plasmid DNA
adenylate cyclase 7
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007406.2-3886s21c1
Sequence:CCGGGTGGGCTGATCAACGTCAAAGCTCGAGCTTTGACGTTGATCAGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374617    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007406.2-4374s21c1
Sequence:CCGGCAATTAGGCATTCTGGTAAATCTCGAGATTTACCAGAATGCCTAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007406.2-1740s21c1
Sequence:CCGGGACATCTGCGAGGCCATTAAGCTCGAGCTTAATGGCCTCGCAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007406.2-2716s21c1
Sequence:CCGGTACTGACTGTCGCCATCATTACTCGAGTAATGATGGCGACAGTCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007406.2-3616s21c1
Sequence:CCGGTCGGAGTCTTGGTAGAATTTACTCGAGTAAATTCTACCAAGACTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007406.2-1291s21c1
Sequence:CCGGACGCGTCCAGGGATCTCTTTACTCGAGTAAAGAGATCCCTGGACGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114896    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007406.1-4306s1c1
Sequence:CCGGCCAGGCTTATTAGCATGGGTTCTCGAGAACCCATGCTAATAAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007406.1-3117s1c1
Sequence:CCGGCCTGAAGATCATGGTTAACTTCTCGAGAAGTTAACCATGATCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007406.1-3863s1c1
Sequence:CCGGGACTCGGATATTCGTGTGAATCTCGAGATTCACACGAATATCCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007406.1-1926s1c1
Sequence:CCGGGCACATCACAGAGGCAACATTCTCGAGAATGTTGCCTCTGTGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007406.1-1426s1c1
Sequence:CCGGGCCATCATTGAGCGCCTCAAACTCGAGTTTGAGGCGCTCAATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007406
VALIDATED
ADCY7 MISSION shRNA Lentiviral Transduction Particles
adenylate cyclase 7
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007406.2-3886s21c1
Sequence:CCGGGTGGGCTGATCAACGTCAAAGCTCGAGCTTTGACGTTGATCAGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374617    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007406.2-4374s21c1
Sequence:CCGGCAATTAGGCATTCTGGTAAATCTCGAGATTTACCAGAATGCCTAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007406.2-1740s21c1
Sequence:CCGGGACATCTGCGAGGCCATTAAGCTCGAGCTTAATGGCCTCGCAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007406.2-2716s21c1
Sequence:CCGGTACTGACTGTCGCCATCATTACTCGAGTAATGATGGCGACAGTCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007406.2-3616s21c1
Sequence:CCGGTCGGAGTCTTGGTAGAATTTACTCGAGTAAATTCTACCAAGACTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007406.2-1291s21c1
Sequence:CCGGACGCGTCCAGGGATCTCTTTACTCGAGTAAAGAGATCCCTGGACGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114896    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007406.1-4306s1c1
Sequence:CCGGCCAGGCTTATTAGCATGGGTTCTCGAGAACCCATGCTAATAAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007406.1-3117s1c1
Sequence:CCGGCCTGAAGATCATGGTTAACTTCTCGAGAAGTTAACCATGATCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007406.1-3863s1c1
Sequence:CCGGGACTCGGATATTCGTGTGAATCTCGAGATTCACACGAATATCCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007406.1-1926s1c1
Sequence:CCGGGCACATCACAGAGGCAACATTCTCGAGAATGTTGCCTCTGTGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007406.1-1426s1c1
Sequence:CCGGGCCATCATTGAGCGCCTCAAACTCGAGTTTGAGGCGCTCAATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001114
VALIDATED
ADCY7 MISSION shRNA Bacterial Glycerol Stock
adenylate cyclase 7
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114.3-3471s21c1
Sequence:CCGGGTACGGACACTGCCAAGTTTCCTCGAGGAAACTTGGCAGTGTCCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114.3-602s21c1
Sequence:CCGGGTGTTCGACGCATGGACAAAGCTCGAGCTTTGTCCATGCGTCGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114.3-2706s21c1
Sequence:CCGGTCTCCAGACAGATTGACTATTCTCGAGAATAGTCAATCTGTCTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114.3-3420s21c1
Sequence:CCGGGTGGCCTGATCAACGTCAAAGCTCGAGCTTTGACGTTGATCAGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114.3-2848s21c1
Sequence:CCGGCTTTATCGGTGACAAGTTAAACTCGAGTTTAACTTGTCACCGATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001114.3-3986s21c1
Sequence:CCGGACAGAGGCATTCTGGTAAATGCTCGAGCATTTACCAGAATGCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001114.2-2846s1c1
Sequence:CCGGCCACTTTATCGGTGACAAGTTCTCGAGAACTTGTCACCGATAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001114.2-2843s1c1
Sequence:CCGGTGCCCACTTTATCGGTGACAACTCGAGTTGTCACCGATAAAGTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001114.2-4438s1c1
Sequence:CCGGCCGTCCTTCAACTGTATCTTACTCGAGTAAGATACAGTTGAAGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_001114.2-2708s1c1
Sequence:CCGGCTCCAGACAGATTGACTATTACTCGAGTAATAGTCAATCTGTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001114.2-2924s1c1
Sequence:CCGGGCCGGACTTCAAAGTGTTCTACTCGAGTAGAACACTTTGAAGTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001114
VALIDATED
ADCY7 MISSION shRNA shRNA Plasmid DNA
adenylate cyclase 7
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114.3-3471s21c1
Sequence:CCGGGTACGGACACTGCCAAGTTTCCTCGAGGAAACTTGGCAGTGTCCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114.3-602s21c1
Sequence:CCGGGTGTTCGACGCATGGACAAAGCTCGAGCTTTGTCCATGCGTCGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114.3-2706s21c1
Sequence:CCGGTCTCCAGACAGATTGACTATTCTCGAGAATAGTCAATCTGTCTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114.3-3420s21c1
Sequence:CCGGGTGGCCTGATCAACGTCAAAGCTCGAGCTTTGACGTTGATCAGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114.3-2848s21c1
Sequence:CCGGCTTTATCGGTGACAAGTTAAACTCGAGTTTAACTTGTCACCGATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001114.3-3986s21c1
Sequence:CCGGACAGAGGCATTCTGGTAAATGCTCGAGCATTTACCAGAATGCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001114.2-2846s1c1
Sequence:CCGGCCACTTTATCGGTGACAAGTTCTCGAGAACTTGTCACCGATAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001114.2-2843s1c1
Sequence:CCGGTGCCCACTTTATCGGTGACAACTCGAGTTGTCACCGATAAAGTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001114.2-4438s1c1
Sequence:CCGGCCGTCCTTCAACTGTATCTTACTCGAGTAAGATACAGTTGAAGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_001114.2-2708s1c1
Sequence:CCGGCTCCAGACAGATTGACTATTACTCGAGTAATAGTCAATCTGTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001114.2-2924s1c1
Sequence:CCGGGCCGGACTTCAAAGTGTTCTACTCGAGTAGAACACTTTGAAGTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001114
VALIDATED
ADCY7 MISSION shRNA Lentiviral Transduction Particles
adenylate cyclase 7
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114.3-3471s21c1
Sequence:CCGGGTACGGACACTGCCAAGTTTCCTCGAGGAAACTTGGCAGTGTCCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114.3-602s21c1
Sequence:CCGGGTGTTCGACGCATGGACAAAGCTCGAGCTTTGTCCATGCGTCGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114.3-2706s21c1
Sequence:CCGGTCTCCAGACAGATTGACTATTCTCGAGAATAGTCAATCTGTCTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114.3-3420s21c1
Sequence:CCGGGTGGCCTGATCAACGTCAAAGCTCGAGCTTTGACGTTGATCAGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114.3-2848s21c1
Sequence:CCGGCTTTATCGGTGACAAGTTAAACTCGAGTTTAACTTGTCACCGATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001114.3-3986s21c1
Sequence:CCGGACAGAGGCATTCTGGTAAATGCTCGAGCATTTACCAGAATGCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001114.2-2846s1c1
Sequence:CCGGCCACTTTATCGGTGACAAGTTCTCGAGAACTTGTCACCGATAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001114.2-2843s1c1
Sequence:CCGGTGCCCACTTTATCGGTGACAACTCGAGTTGTCACCGATAAAGTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001114.2-4438s1c1
Sequence:CCGGCCGTCCTTCAACTGTATCTTACTCGAGTAAGATACAGTTGAAGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_001114.2-2708s1c1
Sequence:CCGGCTCCAGACAGATTGACTATTACTCGAGTAATAGTCAATCTGTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001114.2-2924s1c1
Sequence:CCGGGCCGGACTTCAAAGTGTTCTACTCGAGTAGAACACTTTGAAGTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks