EMAIL THIS PAGE TO A FRIEND

ADCY8

adenylate cyclase 8 (brain)

66 Gene Product Result for
Synonyms: AC8 ADCY3 HBAC1
UniProtKB ID: P40145
Gene ID:
Human(114) Summary: Adenylate cyclase is a membrane bound enzyme that catalyses the formation of cyclic AMP from ATP. The enzymatic activity is under the control of several hormones, and different polypeptides participate in the transduction of the signal from the receptor to the catalytic moiety. Stimulatory or inhibitory receptors (Rs and Ri) interact with G proteins (Gs and Gi) that exhibit GTPase activity and they modulate the activity of the catalytic subunit of the adenylyl cyclase [provided by RefSeq, Jul 2008]
Mouse(11514) adenylate cyclase 8
Rat(29241) adenylate cyclase 8 (brain)
naked mole-rat(101698293) adenylate cyclase 8 (brain)
domestic guinea pig(100722340) adenylate cyclase 8 (brain)
sheep(101121944) adenylate cyclase 8 (brain)
Domestic Rabbit(100337882) adenylate cyclase 8 (brain)
Zebrafish(100148976) adenylate cyclase 8 (brain)
dog(482045) adenylate cyclase 8 (brain)
chicken(420328) adenylate cyclase 8 (brain)
cow(535017) adenylate cyclase 8 (brain)
Horse(100055961) adenylate cyclase 8 (brain)
Horse(100057796) adenylate cyclase 8 (brain)
domestic cat(101087555) adenylate cyclase 8 (brain)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA024291 Anti-ADCY8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2100055 Anti-ADCY8 antibody produced in rabbit affinity isolated antibody mouse, horse, rabbit, bovine, human, canine, rat, guinea pig
western blot pricing
SAB4500256 Anti-ADCY8 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
S153 SQ 22,536 ≥97% (HPLC), powder human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009623 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009623 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009623 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001115 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001115 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001115 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001115 Rosetta Predictions human pricing
NM_017142 Rosetta Predictions rat pricing
NM_009623 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326914 predicted 2406
2 SASI_Hs01_00149374 predicted 3706
3 SASI_Hs01_00149375 predicted 1475
4 SASI_Hs01_00149377 predicted 2578
5 SASI_Hs01_00149379 predicted 1226
6 SASI_Hs01_00149380 predicted 1458
7 SASI_Hs01_00149381 predicted 766
8 SASI_Hs01_00149382 predicted 1607
9 SASI_Hs01_00149383 predicted 3097
10 SASI_Hs02_00326915 predicted 2176
11 SASI_Hs01_00149376 predicted 5395
12 SASI_Hs01_00149378 predicted 4232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017142 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091470 predicted 3304
2 SASI_Rn01_00091471 predicted 3602
3 SASI_Rn01_00091472 predicted 3384
4 SASI_Rn01_00091473 predicted 4065
5 SASI_Rn01_00091474 predicted 1975
6 SASI_Rn01_00091475 predicted 2683
7 SASI_Rn01_00091476 predicted 2192
8 SASI_Rn01_00091477 predicted 3535
9 SASI_Rn01_00091478 predicted 2255
10 SASI_Rn01_00091479 predicted 4053
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009623 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027027 predicted 4026
2 SASI_Mm01_00027028 predicted 2405
3 SASI_Mm01_00027029 predicted 2678
4 SASI_Mm02_00316573 predicted 3025
5 SASI_Mm01_00027031 predicted 1894
6 SASI_Mm01_00027032 predicted 4635
7 SASI_Mm01_00027033 predicted 4484
8 SASI_Mm02_00316574 predicted 4413
9 SASI_Mm01_00027035 predicted 3104
10 SASI_Mm01_00027036 predicted 1744
11 SASI_Mm01_00027030 predicted 2361
12 SASI_Mm01_00027034 predicted 2752
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009623
ADCY8 MISSION shRNA Bacterial Glycerol Stock
adenylate cyclase 8 (brain)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009623.1-1450s1c1
Sequence:CCGGCCCAAGTAACTCGGATTTCTTCTCGAGAAGAAATCCGAGTTACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009623.1-3677s1c1
Sequence:CCGGGCAGGTCTCTTTCTGAGTTATCTCGAGATAACTCAGAAAGAGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009623.1-2549s1c1
Sequence:CCGGCACGATGTTGACATGCGAATTCTCGAGAATTCGCATGTCAACATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009623.1-3899s1c1
Sequence:CCGGCGCAATATCTTACCCAGCCATCTCGAGATGGCTGGGTAAGATATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009623.1-2270s1c1
Sequence:CCGGCGCTATGAGAACGTCAGTATTCTCGAGAATACTGACGTTCTCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009623
ADCY8 MISSION shRNA shRNA Plasmid DNA
adenylate cyclase 8 (brain)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009623.1-1450s1c1
Sequence:CCGGCCCAAGTAACTCGGATTTCTTCTCGAGAAGAAATCCGAGTTACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009623.1-3677s1c1
Sequence:CCGGGCAGGTCTCTTTCTGAGTTATCTCGAGATAACTCAGAAAGAGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009623.1-2549s1c1
Sequence:CCGGCACGATGTTGACATGCGAATTCTCGAGAATTCGCATGTCAACATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009623.1-3899s1c1
Sequence:CCGGCGCAATATCTTACCCAGCCATCTCGAGATGGCTGGGTAAGATATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009623.1-2270s1c1
Sequence:CCGGCGCTATGAGAACGTCAGTATTCTCGAGAATACTGACGTTCTCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009623
ADCY8 MISSION shRNA Lentiviral Transduction Particles
adenylate cyclase 8 (brain)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009623.1-1450s1c1
Sequence:CCGGCCCAAGTAACTCGGATTTCTTCTCGAGAAGAAATCCGAGTTACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009623.1-3677s1c1
Sequence:CCGGGCAGGTCTCTTTCTGAGTTATCTCGAGATAACTCAGAAAGAGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009623.1-2549s1c1
Sequence:CCGGCACGATGTTGACATGCGAATTCTCGAGAATTCGCATGTCAACATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009623.1-3899s1c1
Sequence:CCGGCGCAATATCTTACCCAGCCATCTCGAGATGGCTGGGTAAGATATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009623.1-2270s1c1
Sequence:CCGGCGCTATGAGAACGTCAGTATTCTCGAGAATACTGACGTTCTCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001115
ADCY8 MISSION shRNA Bacterial Glycerol Stock
adenylate cyclase 8 (brain)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001115.1-3304s1c1
Sequence:CCGGCGGATCTACATCCATCGCTATCTCGAGATAGCGATGGATGTAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001115.1-3732s1c1
Sequence:CCGGCGGGAGGATTCACATTTCCAACTCGAGTTGGAAATGTGAATCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001115.1-3231s1c1
Sequence:CCGGCCGGTTTGTTGTCCTGGAAATCTCGAGATTTCCAGGACAACAAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001115.1-2499s1c1
Sequence:CCGGCCCTAGCAACTCGGATTTCTTCTCGAGAAGAAATCCGAGTTGCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001115.2-757s21c1
Sequence:CCGGACGCCTCTACCAGCGCTATTTCTCGAGAAATAGCGCTGGTAGAGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001115.2-3910s21c1
Sequence:CCGGAGGAATCATCAAGGGTCATTACTCGAGTAATGACCCTTGATGATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001115.1-4996s1c2
Sequence:CCGGCGAGACAATGAGGAGCTGTATCTCGAGATACAGCTCCTCATTGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001115
ADCY8 MISSION shRNA shRNA Plasmid DNA
adenylate cyclase 8 (brain)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001115.1-3304s1c1
Sequence:CCGGCGGATCTACATCCATCGCTATCTCGAGATAGCGATGGATGTAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001115.1-3732s1c1
Sequence:CCGGCGGGAGGATTCACATTTCCAACTCGAGTTGGAAATGTGAATCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001115.1-3231s1c1
Sequence:CCGGCCGGTTTGTTGTCCTGGAAATCTCGAGATTTCCAGGACAACAAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001115.1-2499s1c1
Sequence:CCGGCCCTAGCAACTCGGATTTCTTCTCGAGAAGAAATCCGAGTTGCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001115.2-757s21c1
Sequence:CCGGACGCCTCTACCAGCGCTATTTCTCGAGAAATAGCGCTGGTAGAGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001115.2-3910s21c1
Sequence:CCGGAGGAATCATCAAGGGTCATTACTCGAGTAATGACCCTTGATGATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001115.1-4996s1c2
Sequence:CCGGCGAGACAATGAGGAGCTGTATCTCGAGATACAGCTCCTCATTGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001115
ADCY8 MISSION shRNA Lentiviral Transduction Particles
adenylate cyclase 8 (brain)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001115.1-3304s1c1
Sequence:CCGGCGGATCTACATCCATCGCTATCTCGAGATAGCGATGGATGTAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001115.1-3732s1c1
Sequence:CCGGCGGGAGGATTCACATTTCCAACTCGAGTTGGAAATGTGAATCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001115.1-3231s1c1
Sequence:CCGGCCGGTTTGTTGTCCTGGAAATCTCGAGATTTCCAGGACAACAAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001115.1-2499s1c1
Sequence:CCGGCCCTAGCAACTCGGATTTCTTCTCGAGAAGAAATCCGAGTTGCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001115.2-757s21c1
Sequence:CCGGACGCCTCTACCAGCGCTATTTCTCGAGAAATAGCGCTGGTAGAGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001115.2-3910s21c1
Sequence:CCGGAGGAATCATCAAGGGTCATTACTCGAGTAATGACCCTTGATGATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001115.1-4996s1c2
Sequence:CCGGCGAGACAATGAGGAGCTGTATCTCGAGATACAGCTCCTCATTGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks