EMAIL THIS PAGE TO A FRIEND

ADCYAP1

adenylate cyclase activating polypeptide 1 (pituitary)

144 Gene Product Result for
Synonyms: PACAP
UniProtKB ID: P18509, B2R7N4, Q52LQ0
Gene ID:
Human(116) Summary: This gene encodes a secreted proprotein that is further processed into multiple mature peptides. These peptides stimulate adenylate cyclase and increase cyclic adenosine monophosphate (cAMP) levels, resulting in the transcriptional activation of target genes. The products of this gene are key mediators of neuroendocrine stress responses. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2013]
Mouse(11516) adenylate cyclase activating polypeptide 1
Rat(24166) adenylate cyclase activating polypeptide 1
naked mole-rat(101722329) adenylate cyclase activating polypeptide 1 (pituitary)
domestic guinea pig(100721631) adenylate cyclase activating polypeptide 1 (pituitary)
sheep(443337) adenylate cyclase activating polypeptide 1 (pituitary)
chicken(408251) adenylate cyclase activating polypeptide 1 (pituitary)
cow(615187) adenylate cyclase activating polypeptide 1 (pituitary)
cow(282402) adenylate cyclase activating polypeptide 1 (pituitary)
dog(607433) adenylate cyclase activating polypeptide 1 (pituitary)
domestic cat(101090471) adenylate cyclase activating polypeptide 1 (pituitary)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302829 ANTI-ADCYAP1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
SAB2501270 Anti-ADCYAP1 (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, mouse, human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009625 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009625 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009625 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001117 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001117 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001117 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099733 Rosetta Predictions human pricing
NM_001117 Rosetta Predictions human pricing
NM_016989 Rosetta Predictions rat pricing
XM_579383 Rosetta Predictions rat pricing
NM_009625 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099733 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321183 predicted 598
2 SASI_Hs02_00321184 predicted 550
3 SASI_Hs02_00321185 predicted 753
4 SASI_Hs02_00321186 predicted 722
5 SASI_Hs02_00321187 predicted 661
6 SASI_Hs02_00321188 predicted 579
7 SASI_Hs02_00321189 predicted 724
8 SASI_Hs02_00321190 predicted 654
9 SASI_Hs02_00321191 predicted 652
10 SASI_Hs02_00321192 predicted 711
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001117 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235767 predicted 569
2 SASI_Hs01_00235769 predicted 517
3 SASI_Hs02_00326997 predicted 723
4 SASI_Hs02_00326998 predicted 690
5 SASI_Hs01_00235771 predicted 624
6 SASI_Hs01_00235768 predicted 550
7 SASI_Hs01_00235772 predicted 693
8 SASI_Hs01_00235773 predicted 620
9 SASI_Hs01_00235774 predicted 623
10 SASI_Hs01_00235775 predicted 684
11 SASI_Hs01_00235770 predicted 471
12 SASI_Hs01_00235776 predicted 810
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016989 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118584 predicted 406
2 SASI_Rn01_00118585 predicted 426
3 SASI_Rn01_00118588 predicted 706
4 SASI_Rn02_00261123 predicted 324
5 SASI_Rn02_00261124 predicted 318
6 SASI_Rn01_00118589 predicted 360
7 SASI_Rn01_00118590 predicted 592
8 SASI_Rn01_00118592 predicted 542
9 SASI_Rn02_00261125 predicted 417
10 SASI_Rn02_00261126 predicted 709
11 SASI_Rn01_00118586 predicted 607
12 SASI_Rn01_00118587 predicted 791
13 SASI_Rn01_00118591 predicted 1567
14 SASI_Rn01_00118593 predicted 1573
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579383 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00187250 predicted 342
2 SASI_Rn01_00187251 predicted 242
3 SASI_Rn01_00187252 predicted 424
4 SASI_Rn01_00187253 predicted 625
5 SASI_Rn01_00187254 predicted 234
6 SASI_Rn01_00187255 predicted 276
7 SASI_Rn01_00187256 predicted 507
8 SASI_Rn01_00187257 predicted 446
9 SASI_Rn01_00187258 predicted 826
10 SASI_Rn01_00187259 predicted 796
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009625 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126957 predicted 406
2 SASI_Mm01_00126958 predicted 335
3 SASI_Mm01_00126959 predicted 617
4 SASI_Mm02_00316577 predicted 287
5 SASI_Mm01_00126960 predicted 265
6 SASI_Mm01_00126961 predicted 413
7 SASI_Mm01_00126962 predicted 454
8 SASI_Mm01_00126963 predicted 313
9 SASI_Mm01_00126964 predicted 701
10 SASI_Mm01_00126965 predicted 446
11 SASI_Mm01_00126966 predicted 251
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009625
ADCYAP1 MISSION shRNA Bacterial Glycerol Stock
adenylate cyclase activating polypeptide 1 (pituitary)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009625.2-601s1c1
Sequence:CCGGCGGCATCTTCACAGATAGCTACTCGAGTAGCTATCTGTGAAGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009625.2-233s1c1
Sequence:CCGGCTGCTGGTGTATGGGATAATACTCGAGTATTATCCCATACACCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009625.2-449s1c1
Sequence:CCGGGCCCACGAAATCCTTAACGAACTCGAGTTCGTTAAGGATTTCGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109815    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009625.2-1370s1c1
Sequence:CCGGGCCCAGAAGGAAATTCTAATTCTCGAGAATTAGAATTTCCTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009625.2-235s1c1
Sequence:CCGGGCTGGTGTATGGGATAATAATCTCGAGATTATTATCCCATACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009625
ADCYAP1 MISSION shRNA shRNA Plasmid DNA
adenylate cyclase activating polypeptide 1 (pituitary)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009625.2-601s1c1
Sequence:CCGGCGGCATCTTCACAGATAGCTACTCGAGTAGCTATCTGTGAAGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009625.2-233s1c1
Sequence:CCGGCTGCTGGTGTATGGGATAATACTCGAGTATTATCCCATACACCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009625.2-449s1c1
Sequence:CCGGGCCCACGAAATCCTTAACGAACTCGAGTTCGTTAAGGATTTCGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109815    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009625.2-1370s1c1
Sequence:CCGGGCCCAGAAGGAAATTCTAATTCTCGAGAATTAGAATTTCCTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009625.2-235s1c1
Sequence:CCGGGCTGGTGTATGGGATAATAATCTCGAGATTATTATCCCATACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009625
ADCYAP1 MISSION shRNA Lentiviral Transduction Particles
adenylate cyclase activating polypeptide 1 (pituitary)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009625.2-601s1c1
Sequence:CCGGCGGCATCTTCACAGATAGCTACTCGAGTAGCTATCTGTGAAGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009625.2-233s1c1
Sequence:CCGGCTGCTGGTGTATGGGATAATACTCGAGTATTATCCCATACACCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009625.2-449s1c1
Sequence:CCGGGCCCACGAAATCCTTAACGAACTCGAGTTCGTTAAGGATTTCGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109815    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009625.2-1370s1c1
Sequence:CCGGGCCCAGAAGGAAATTCTAATTCTCGAGAATTAGAATTTCCTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009625.2-235s1c1
Sequence:CCGGGCTGGTGTATGGGATAATAATCTCGAGATTATTATCCCATACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001117
ADCYAP1 MISSION shRNA Bacterial Glycerol Stock
adenylate cyclase activating polypeptide 1 (pituitary)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001117.2-959s1c1
Sequence:CCGGGCCTGAAGATATTACTACTTACTCGAGTAAGTAGTAATATCTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001117.2-511s1c1
Sequence:CCGGACGCCGAATAGCTTATTTGTACTCGAGTACAAATAAGCTATTCGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001117.2-481s1c1
Sequence:CCGGGAGGTATAAACAAAGGGTTAACTCGAGTTAACCCTTTGTTTATACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001117.2-34s1c1
Sequence:CCGGGCTGGTCTATGGGATAATCATCTCGAGATGATTATCCCATAGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001117.3-354s21c1
Sequence:CCGGTTAACGAGGCCTACCGCAAAGCTCGAGCTTTGCGGTAGGCCTCGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001117.3-709s21c1
Sequence:CCGGGTTCTATCCAAACATGTATTTCTCGAGAAATACATGTTTGGATAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001117.3-813s21c1
Sequence:CCGGATACTTTGTGGACCAATTATTCTCGAGAATAATTGGTCCACAAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001117.2-403s1c2
Sequence:CCGGCGGGATCTTCACGGACAGCTACTCGAGTAGCTGTCCGTGAAGATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001117
ADCYAP1 MISSION shRNA shRNA Plasmid DNA
adenylate cyclase activating polypeptide 1 (pituitary)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001117.2-959s1c1
Sequence:CCGGGCCTGAAGATATTACTACTTACTCGAGTAAGTAGTAATATCTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001117.2-511s1c1
Sequence:CCGGACGCCGAATAGCTTATTTGTACTCGAGTACAAATAAGCTATTCGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001117.2-481s1c1
Sequence:CCGGGAGGTATAAACAAAGGGTTAACTCGAGTTAACCCTTTGTTTATACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001117.2-34s1c1
Sequence:CCGGGCTGGTCTATGGGATAATCATCTCGAGATGATTATCCCATAGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001117.3-354s21c1
Sequence:CCGGTTAACGAGGCCTACCGCAAAGCTCGAGCTTTGCGGTAGGCCTCGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001117.3-709s21c1
Sequence:CCGGGTTCTATCCAAACATGTATTTCTCGAGAAATACATGTTTGGATAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001117.3-813s21c1
Sequence:CCGGATACTTTGTGGACCAATTATTCTCGAGAATAATTGGTCCACAAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001117.2-403s1c2
Sequence:CCGGCGGGATCTTCACGGACAGCTACTCGAGTAGCTGTCCGTGAAGATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001117
ADCYAP1 MISSION shRNA Lentiviral Transduction Particles
adenylate cyclase activating polypeptide 1 (pituitary)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001117.2-959s1c1
Sequence:CCGGGCCTGAAGATATTACTACTTACTCGAGTAAGTAGTAATATCTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001117.2-511s1c1
Sequence:CCGGACGCCGAATAGCTTATTTGTACTCGAGTACAAATAAGCTATTCGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001117.2-481s1c1
Sequence:CCGGGAGGTATAAACAAAGGGTTAACTCGAGTTAACCCTTTGTTTATACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001117.2-34s1c1
Sequence:CCGGGCTGGTCTATGGGATAATCATCTCGAGATGATTATCCCATAGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001117.3-354s21c1
Sequence:CCGGTTAACGAGGCCTACCGCAAAGCTCGAGCTTTGCGGTAGGCCTCGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001117.3-709s21c1
Sequence:CCGGGTTCTATCCAAACATGTATTTCTCGAGAAATACATGTTTGGATAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001117.3-813s21c1
Sequence:CCGGATACTTTGTGGACCAATTATTCTCGAGAATAATTGGTCCACAAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001117.2-403s1c2
Sequence:CCGGCGGGATCTTCACGGACAGCTACTCGAGTAGCTGTCCGTGAAGATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks